%PDF-1.7 % 16 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190625150256-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 17 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 7 0 R 8 0 R 9 0 R 10 0 R 11 0 R ] /PZ 1 >> endobj 17 0 obj <> stream x\]s۶}8 ~͉66ic߹i${.@J%g\;iD'4%J<Ş|/J|xOW8yrE?2Ϸr5'ϮN^3#N{O%qQ ɫǿ_B?Kc?x~nŏwgs>>Foϭlȼfq$^8vWߗmW V:עx`ZT5Yqӊ"W?6Ulǖ:l9R Ѳ R.5QsbriRH^pR7JO_2QeٵnGw[0eC}C/b7n+ׄ4dtQ%qT'Q4d;˓ 2)[n)H<m8[cq- xA8tg<`N^(0 Iz!eay> h-/(]$syA(hB0f^5F&Tց; P&,R"JD%sL_u^v(~'œLd Q @ ͭ2d%{jrH˲9Gh0d*WiSKߓ_o&o ^̶|Qʼ=p_ 2Fè'bEsΗpp-xi}x{WU>=@QgnuҤU6pB8Ea̵d( юC f)٪zMhޒZh#,b4a*49/{J uNCο>'.$/oVcu$e,@QJX>8uӯa}A5j)`6αQ/EtqIM7+Ydm#M^eHDBޘGi|O5Gaud_^oHܭ?] кpꅬv_"!gCT 1rQ9@[L1'O^jŵ+6V6; XUA!UӇG6{mAJ_Q}^ќH 4P!e{Sq|fwk2ܘ%rdqo;-H!x4PMy 'P_VpW|ᨔ[JCc?4N86@ Xw\@kIG ' 2}Xe~p"hccnu 1xRG0}#VLL ZUƖDmzwRxYlm )-0[Jg,b@OE%@%:ci*:PPFf䡥ؑ:Gh@~ݢ37vˀQ-g5ڥk xg\<%v$<4Hb쇗Q1FF$:,ԡ1 ͸켘yIf_ h`\&(`zau,,uzkT!hj>3B_ Q8H]VZzFƎ;}Qy)/ n)!gDE kT.7ύQ&0e.Wn. 3rKQu#n:|TjOgeEn=Tڋ)%xbo,yޕT W0Ntǂ2S]E/B\5XZjU= dNKx=tVy{K/#m R~i~I5D@m$:\F;Vܿ,0sD N QR#u&f[rxSǂKpQ~;xX".i.?)д7ͶRUrm1KF>U/ u[3e,!QWS-__:~EGD,Ki5Xo6MƾGpiNӵw+=BcM@ڶg) RG0YBjB'Re|LZ%V"QR BG*YO*3=wAv&ox ;cIq5L\\DZYQD^:CT]YkgK̳eh_sbT(i ٯ N,~8(ԵK [j&_'A-lluK{,1}9l&61`EH<%chA:Yv[. Y-% p:S+RZbQ oW[ ƒgFd͌QG-*boZ4y c!r,/MX=4 ~ㆡ# ,v?(yLȠcu endstream endobj 18 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190625150256-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 19 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 12 0 R 13 0 R 14 0 R 15 0 R ] /PZ 1 >> endobj 19 0 obj <> stream xX]S:}ϯ2CY-)3$w3VbSre ^34%Y=%<( )P,Gb{?Chh ǣ}xJ=7K{{ ){o#d+m0>l|JD~ȁ8ܡR3NJ~~m¥&K2j7M{G>CI[%:U\縒eهJAg0:5}-h]u*o28iUqBC\]DAys.d.YA6KM (EΓB<s-fhQF#ĺM!&Pˢh ji?G8$2{YtGNFî|;|Vpn 0~iO'y|A;Ե-ޙyrC-WR"ZʩC`6fyP \[ɊuUlUGY%JhaVV14nLʿL5\-մŸUo cPmDosgVfe7hD_"vɃ+[q% OS:ػ1wx|ffGY:=ax1nQw\G?oT",D> endobj 3 0 obj <> endobj 5 0 obj <> endobj 6 0 obj <> endobj 20 0 obj <> stream JFIF,,ExifMM*nv(1~QQ.#Q.#Paint.NET v3.5.11Photoshop ICC profile XICC_PROFILE HLinomntrRGB XYZ  1acspMSFTIEC sRGB-HP cprtP3desclwtptbkptrXYZgXYZ,bXYZ@dmndTpdmddvuedLview$lumimeas $tech0 rTRC< gTRC< bTRC< textCopyright (c) 1998 Hewlett-Packard CompanydescsRGB IEC61966-2.1sRGB IEC61966-2.1XYZ QXYZ XYZ o8XYZ bXYZ $descIEC http://www.iec.chIEC http://www.iec.chdesc.IEC 61966-2.1 Default RGB colour space - sRGB.IEC 61966-2.1 Default RGB colour space - sRGBdesc,Reference Viewing Condition in IEC61966-2.1,Reference Viewing Condition in IEC61966-2.1view_. \XYZ L VPWmeassig CRT curv #(-27;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)KmCCj(" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((p <'IyPHM=xGYvE׾0O֠tmhkEW2ZF1VU{V8t|Z5/3^ԖVZl)ȮǪ^jnӓwְ~bh{Kj|5Q\EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPQ\\AiWSEmmm$0[ 4M42QFI#*"+30PMK_ 7zw/|&5%MO㏌tqb{.mkdK7 kwGXL3TӊMн-U*JIiN*Cl>Qxԩ7ɇ_[::j JR%qPtߍa<gE|D2K㿌ƣwΟ 4kk=6 gi9-eӬGmt_AsS֡l R(l>uafaLƄӿ5,f" >ZI=wMhFr쾼\+`p jϵ %1׿KQ222ů跚}]tohV7")Q4' #G^<_<+}/Y؇f?I/a+; mJ$6Xcx7M3^A~??jo6ÿ<-p&{H{R{4^Iռ- 7<1"cvnY-O)hlmI=UN0f1KxbFz?u~S:ξ 7N/zZ䎲*2:GB]X  AqNk?~?H<o_~fG~Zg-ÝZ}Yv,zl]sw?_~o;,s$v\^J^ZpVѵ;kMWJk-F"_71ʥ1Xj2pF*yF:[Iԡ:mUa1)PJx\e8Ui˖*GaܴUiڅXөx/L+;Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((-g}1~Mڳh6ռ^ZNa<7k[hZ a"6/N.tB+~m-+Ǻ)~&\%>e54ovVZߌ,*>>[Wп7^C01RUeO+j^8$^DK4vе~ !ŨUN`¿m/JC]kƩiT xuVP^1iUm5<%E*+HU&-|:qE +S+',6.A8uԪPBUhTV1inhU.z5Tɦ^%*u`:π~_ / |7;;g|G_i}^wt)|; ߇[[N4/scqiwqu>|Mֿkk@յpML~:Di/xt+y?78osFm{Cu]YuKK[;#fc^ x*Qԫa+4)$*ҋ#Nࣞ*Ҝ|6񧇒h;ˑR;qkMúu#Lд4z=Z8YYE00D=+NcORy}Iy&(wv1x,!E+c$#O//ھ8? t({^~/2L^o>oU32Oُ _h?QI[~К%_#bҠu<3\i>3V.C~ΟdO{'h_ .Mnmc4]SleJмTmc7+ Wӯ"Vut cW*7,olNY>Tk*܎3 B=a̻GO YqE+V0# 8 AK_?d~z>|LOZhė/'H$aⶹ4"jԾH-Ϭx7,@m/-5 h,.m'+iYS:@ee<+УF6&8,|V/|gQj2 ͬ6F|̑]S,'$y|\6YqŎ ӵvqUVcLhKkB~-\u`xV?9J+$4^I{jq5\-{٤/-I,gr{\~f]8OkI' wXɕV޾!]>PGʪ >Q_1ٳ{#]O"]7zq>urܯVYo| OU:_,={Anڷ^?٠TU*p o(Z|/PcG˻>.!jr''M}vgkچ!?gѼ~>$hm9g>Ɇm|E_QN? xۧ¿?A=>񿃵Kyܠ ]!C\K V:嘅<%X\E4+Z,:u'x\GR*cܘO^YFQ/l;NqX5(EuY]Uѕ2*  AȧWdj?Y5os Ʒs4xOM/kFB5mG$][_y,;L^6oɳ2ye_䧆|{]yDiL_D>?K Nb瞫zs]/|N{jT+AS}?~[_?Ɗ |=?oGuow8|sm؅#M刀C,O⾗?t?[Oq|B𗇵ŗo͍⩃1cb<3̒o6F+aV& Jk͝LE*u[teoH߲gH̨U1@I'rkm Ak~5;Eֹ;T䪿`)/r|'ĝGNsnc^6$3xL^UF|~%%Ojɳ汼!xW+U-U'zj{|(ĵxPӒ5}4NdVQ#PsO>ZZ>IRͣi3䗴6HM##0 U2#Mq)t Msޙ mV;]L6o":YkZ'g̵kZy]֒Z5ug(xkJ񆃨xwYWJw0zzӵTMRإޗYYGsm[UJ61B崋'O,-"Yokv߇:,u{-z6mKLI`8_RѮZ7J k-;asog}J[7i'J2P,S[ۖ_ލێ/렢,i,l9dאXFR4Ȱ((kR|ET^qSiLq*ݳ_-*v4ا˜Zď> xR?/9huY!8BX1qMt+.E RoՍ-UoW$~~v¯Vw&8.6#{~)i^:`̶v"MD[;56)WJmv8kubC~kj9{OƘ$8<y۬OUNZ8U(EumUQEEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEi2N/_x?WMH<5i=ǧ⏌𖸭H|?y\AZ܋S 0Of]¾a`ʳiF*(SYB'jsNn0n;'όSa18ʪrԍ4:Rj R\bTݯ$?R _u:w?5 N8 _d?W"NE@ٯqtWF_X/:; Κ GSQW;!¼ս.Iȿ5On?Ί0 GSS4jm2@:bSB7—A^+܇ s"NE@ٯq4WKoxrxyӧVj%SvMϚx|[0FPtu 1N/ީJ]+$+woE̍"FD/ş^3Ggk?:3? E?c~#_/5?ڏ/n<?|'ӭ]ER<+i|=L rNoO tHW$*`AubzSj$2G/FeQ֣FҥJue(b*I{iZj(;>((7?ୱ΢"OvO߄_'[x' o/dh/ş^3!9L+A?ਿ>LoB><=REOze7|=q6^'.<]޼\>(đ IV. r x<˰٦ |V.5!(NTҫ$VHJ%)E>Î2[QEK Fq87p%EgNuf?"F? E?c~#^A~, 8#?3|?5E(_o_xþ#?~!| g?:e{/>z~cPj/4vfgK[(= 0ήUF)BUR:V*QNRɸE{>)p 9N5bV˖Pj2&%_P+=  wh_7W[񎓢 %/Ik]+Vmi!_i7m?54d_ s\x^0kf. SK B U8ӂo[.i.imݽ'K % 8zSVoœ\ݖv얬3? E?c~#GDn1 gdWq>΢"OvO߄_k Kq~fuOA_w7R>ݩSol$5MXi4RJ_ OKq >JQJN_c馦|AqP*VRB8|=R!׻HA*8Q(i.8a;"iEIH.a3Q~2A'{W :h '  7.fshYRCt joxMKže`I3!em繟OA|B[c%~.UW$l9ãi$drk\\10o5ijӼMD\g9U8e.L-)Ux|?'Ν|ǿJQğN[h>M8urkdeYiivYevIYw%ؒYI9^Sr<ɿ,m I~VE4W$Kȡ'Y"OFIu=I_/|r׌x$K x[C=8`zW ib[g?Hl}N׍.~,h݆- ^4ѣU'1s;0RxtX|~Wת:x_Yʱ4WCKJ<2s/SeK: 54h/~|C^Y(<ԷŖ7!7C_NI+⎦OixVS$+ټ9rivZjZs/|s䐝lFY,^r8o)ӂXpKW:xA-壷_fr:XЭ-d~6ьɽaVRod~W/_ODŽ|Gg|_/t}#M//nl"Wy Aom"J,NG",Idtu%YHee$0 A(O;G>Z_5< >|Þ*/MCW׼!MkQw@͇QE7#ޗ-d}<bq`X~2{aTٹ֩9BTRZpQw=<&΍bq5$ap֯4b墌#ʥY)Br?' mC-&xgÖ4stR>[M}y_6|-`p?g"OXHf6Kl3^ YFg];ÛiP]O' ?b ?f'-u$[wآvw?Qx;ZOWzݯ8.G|3k}C>?4MKK{KxZ%ީsk㿉nk{i0y^K{kE2jީr^WCo r_^M#[@aO"]+Ԕ0n**R8TܪR9Tgjxl- hFtpS ^BjM-YI10T]jI .?V}83_k:V 7_|c[R/xoG%'<54YAᛤִWF4MkEZB"KYX Wuiy`JK)"H XHݥ.~~76?j_д˸IiĿ.q,>Z-+SEMk×2j7)8F6k8 /VsZQb'ůUZe|8W^ YRQc14+ OѥNփ*?qM?|?59LPz~$5o[91_6 #LIe𷈾xˁu-OAd-gsZOse"洚o7V澃MzN+SVUTVyX48vh)󃅶l= 1cקOoqӊo"}?P~~+4a>#}^3=OHot#r:cmz>Ƥ(L~Mm~[Cߍ MHMÿ\Z8nu UGO;ﵖUGYwp52RVNnUEäZ=p{ /h?Bꬩo|N[#_|<ף)xXYa/-$"Kk-;)H>6ݹH_ixOkmg ZY2^$䕘37OG/¿|^!Q;!wg/ڻg |G4. QhoS\<2CxmBͷ eUfN?4[Gթ ߊS]K "]}KZȵf0\cIKL$lq2[2^xlEG ?SQUn֩R/,8pZU5:NaEWQ@Wϟ?i߄czۼI `-O2]5t6L24sjv+2nkQpR8z5+UЧ)[v*+v3V:gp[N]薯 ;W_{_4X/nbO*c޸sD(Ws_^7~)x9woOj6oۥi_ >P/fU" "aZ?_ $TVJLE X\t3Q^!OmG'#_E{˛i'2J>kkR_.?dQ_.Ǟtź Ǐ-oYLt l 8q> %xOm;zm$ݪgVdImܵ#oR'om/3z\EZiƢ^~GE~z|"|5񌶺G}6"]Qm[Spo5@2n5p 6P;;POmsnC<2) ;Xlf_z[+N%HSɵdzaQV5-%AQIj(#(_/][~jnڇ4E?Ԭ?n#z\Xp_Rս>|?ếj(Ofv~;YG @SmCЃ/+5_ޗ?woC t_( H?E#|zغZUA(*~.Y|KoeI5 ޮd2ϣGck}_ڵ^Rab8S9%F!-_R&^,/u'I\[KCH/uxJ6J,iWRoi,ZtToL8a {zt*u!:u (N.(&IeJ%x-J-wM]5QEAAEjV]a6]XYzk"1 "HmmI$7d-[z$FwynZ-Nm]I.XikwյuY-u)c`o?n_/Jx3;K`uKUI.ߣpm M*R΢}HN#:n*r%ҊR`# [J;o5=>чUYEWy{۹i|khO.MvFV nɷZI-`JR/W_D /{c}gX]Ł-ַ1dyNʙ29-#8h?ɔ%MyhKV7׺e힥iuo}acq-=VȒ*$?O!W~ oO?"͇ $v̑ëNbX?5Y ֩g/Ɣ# GЃ_?Ĝ5F_Sы|x\\c5֡QKRo֊o[&α&.FmM4V;m~IMh4C~WnK@K|lX~|Hԯ ƭ}.MwEi.'t}[RKg~61_#)b<&N197\`jf*8ߖ|n-¬/gSqMGU^#mSUynhJsӚ9Nh6Z( _nw΍l<&>_j*:o0o>?,AQE@Q@wW?7jV.&эUl'QL?b} zxx<5߄ZDO \rT'+Ѧ&#͑)Oxw] xI|MmkT=NԴmwDLB@$ӵ [;xde5BG5s пloecQ5ŕ|zlMZIXmĿ Ge5h5 #&cUKPή//zCN?4!"J9?`&,6sBBekT欜WmFE~>}(~4h^:Wtdk?Vt .ޱT<^FU^_OßuE| K~IqJլ$y>o жl] nl/_޿o$3|\^|#Nf>"j?oW*4;ttnj=|FS%Gʵ_JOv\R0Wu[[*+QǧVoH.PRMFVhf?i >:K?j^ >bYϾWM6 x.<qYw8ҮcI` l'UOأQL {SG7Dѕa KYX],MWx⇎g+Zψ|k^ 񯋵Y/5[o\ u{srQU@wy+qC,O r^YY-,U9E#gW(qWĤw{jBqzH䨢? @_5 W{D7ğJ? ܥ~ڒu(?Zzk.Ew +Uծ&7I(x㾃ڑwXW? ky-H\*"^hQξD2 _⧁4÷  ^tQលa'[P*xo: ˴klX|/> d1i_,[`YMVXt鉰}R(2]߃<چ:+%ּGk SZ[mV.AecAii6VߟS?i7mCӾ!oq[IxCIT鑌Wn"H`pTک׵}=΋/#Wþs^64MEhT /uۂܹoʿ ?߲?3@.t/ߴ7O~"u^ S@IhZ&owI5֝sWVGM;YcO:YV#, G\Ja,<%|B J_#-hx6Jŝ&a ?<㵂$DEĄyzlٳo&߳_|@hIx“0,v""|v$Uۆ, o~5į6~#|"A|UnAmA*g]нŅڨN5b *pj.`5KںU:Vs:˳^]NQIԡ?sFmsΜ֊(=SS.#>3.}Uss?7{mF_u)# z;U~߷Bnj4O kR54WZ&5}gJY'УIo7$^1]"RKmWžd?=eC?g}/'m"?Kk, |Q'SISL>uٞ%Z[RIeOǯc[FuJJңOJt{4`ÞkʲѶ?^a< +T࢞'9'5k'.Y/ ?d߃c6O^/Yb0ݶ:u |3ỘdU&Ds*~Uk+;M:O`$$c!DUHEDP _y:gbߖXhsrǢI$?wapt ..ֺN4ԟnzQ\'HR$$I'{5^lRoꖒI/cm$Cn݅ƢI*$5v](i)SW*q=IyE;%u''y#:6s E9l_-n/_Fi|Aجl.jWpؙG8zJ4j8+CUu]JCG˻ӵ[+>LgeŝpB9$jYԚi4M&4M5Ml֍Y}j/?uHa=}_Z̟`u=ދ3 YŲ5Ѵ|EcPѝ M(V5iBjɧdԢLҕj*F)]OOwMhB|.iD_iPj:F#]i:[_17h+I,-%Jpf?~dK3!5HƎeOCq}3[jniޏy6l,/KK_" >gbRL%{QJRsE8$~,#whקeV g},WGo=^1_??qc{^0X.'oʙE)E8{L :l&*<;ȥY1Z9'h ^+r1LHufmт%ƛt_^:u~*~&gztk ĵbc[wG:d$ٸ7$R^}pӜ!AʅTUG=ɩGNh3 *Rxy*oHEtwvEUԬ5㺲$xD=Ձ[#2*c'*tۆ.тu-wGKJEW@QEQOX|G|uڬS(~wOx:4u;[q dy "<S9pI|0/H'"9F yIEz~gÿ1ys& i3op];Ir!˳QE~ RrRu%T/Y,2P`TWRKAETQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3~OK~>7|]Zt?0x}n_=J/3W_{/ԺG{W|oҾO߃>.xf[SV%76wlʹtK?S-ŝHERVHVVN)ʝHIm(N J2]ZgJp ST5iBT$ROV? ?OΣ2r\ .u2оu|;ԵjLucTs_iV.ửXw+kL1_CQfQyX7KeTӿ5|>3|ג9 u?*4h n 'w*ۻO+onXE[㭍\c!IW} oT=pG#)b<&1xP'5\M[urxZk#|-i2kӣ(4QE~~p)_~ &럇> 6?3ᚿ4,Š۹} xƿ:[H|aS3P}Q_ȇQE*s_ƪb>o^~GxQEh!x# ʾUd_gE?"C⏇wj !Oזe-wIWWbe]}Pb08X-GKGBwZ5UJr]z5M3t)bpׂFFҧR,b޻֧x(s/|>{Ě ҤhqxV(5Ù"pX)֤&h>7g:|-i9*+/w*5Nm[ђUt鸹%uGx ~ڿhy>\/:I#k_ |Z?"d_]އo*'4-n Q^3 CPU0غp鿷J%Nn2v}X|E\."&+aӭJ_RҺ?ڇK4oLӵS5{ MSKԬfK-CN-㻱)n{yfXGF*%vkjo' kڧ۾#~wʼnZ3wj*S['GIF# CmN=%(Oqg'ZO⟉_ `jŴ?6~5Gi?usʌxcZ-[]}\an)z׷~ҟ]NAV_ojPxJ{7@g4c1QB^#_\)܃.ʡJ#<\㯵*kJQ{ҍ8^G{8q%Z4"a#nJvJrݰ@@Po{ Jow]F,qZ0픗':ti}~]^8I)6Y8<6 \EiP&+(ӂsbhakcqX|&<5aFzsNJ)o9=#LA?_O,Vfេxo:L~b?=AD4[-6uX~-], S7T ^b/{P15)Y?+ -.L,t7NxlllK{K;;X8-m8mD#ApݯaK|! bs? x~pS9U_Y?ZNa6(qO B ,)Ҍ%'ltn pB%4J7eZS䯣#֢+$+''g~/ًN<5Uu?x.|1zM<_YE:iZtG9,Gz#g& a_(OMşoA_}F_y{a~& S)u{:PNsڸ9.kW+*<< #93t)IPߕC S2SIC<^8IQu"sM5-?ыliw4 ~is鶐[>|c'_$[xĶZ繛̹6oYI4i:fgτZF O_ÍFhoȈ0cB1ox' MH %Oƿ׉l>|,VnCco/'1J2p ;Z ~ʺ75Iy:¿3س4/ U/5yApyi3 㷰/GUQkiV1e˰UZ}iH 5_'7uKa௏"gپ Úg$Uva K$K/w 8c+w<[Ɵ+Wn5kؼ9k=X/4?o3wVFWֈIiZ[4n$β晃a"#Q7F3)ε(BUi~Ѫu!hpMa,=wJtm $8J4)(NN唗+normSŸM<ؿ>/^.:xGdPˮkHʾsƛ|-'U+LcOt|~mݕ/Q\[Mѷ#޾jGR~~/kO Uƌww. mi=B`)v6|g 7ѼE$I%IWUӯ%xuo..Stݮnd{;0\5XkW&q1ZiQ%q8LU&/畡+8Ui7ׂ'GBvГQE|Q@g_~_|2mօxk_i@HtSD\Α]ZM0̟wr5~~*>)|;n/Mcݤ]D^ jC%-kݽZYůu\xWpg|+^\J`uxU))BQvUhԥWn/r =cΕ""P^#8_?&#JTMv2,>x{s[aĺ[}˵d4[^\L[$.; }~_Ǟ~ K¿w_> ^4[JW4qnYx÷>|x.oh6D_« EoKiL6 #O'Ú42Vr[}M#+^Q%(I82q^QviSRJQwRIiPW|z_-ZRG FU}~?x',[s2~or}@M矨?=7T=KEYoWIm.4OLlf{k B(nm.# [h)QYGyniaUXz\V*8xFU)s-!\|r=f7p6 ,E6CJMBvTkTSwJ\bC a,Et^gͬ| m$&x,Mq62SZUzO./'!mׄ|{Vӈ]"RO֡[Ά?k>Xg23]hΙ-:EΛ:uc隍X]Eť\[OM "+jo[?-CX|*ß jz6vI[7گ}:59]]2k MҎ}qcexaq+,sTKhQԕl-J1U(JΥ; S(+rhc› jSu'NT*|m/%f$I$Iy$Mkic$kvUfI>&O$YG 隭ƺI庆? oσ_ 5P񏇼 -*=ʷzu;m*3*H-,!n5}77,4x3;~ ~>X@K3òKI?I~0u J_^%NȮIb,H/ rd*[O%ד}}*Sxsx{xŞ=^Ѯ/ nDZvmOQO)3_|MxĚAt׺׈uK_RlKy%%xSۤPFqR>g)7ucRD6XK)(;jNiGΤT?)S1/ ;Ql*5]G5C8xOWLWGo=^7|OV}Q_*Q3D صֿ"Zпk_?NJhM/4:HJV2X G |MWFƃxSfJa^-u $ڗ1+G ^ZJw4WX%XUiA{tQ{88]4>U֧RWZ5fUUc%|'}Z}jv,yapd‰d-Qx9:_]VvߏȨWWho&1Q¼ȱO'B+Hr\%~߂X<&&KX5 ҊJ8ͥiyb)8SV4Bn);-B(01JNmOF3ӧ/ N2ٜMQ_.$QK<RM4$P4,8w܅DPYPI'{/zƯإ՗Ώ['#9-x öŵ.$u ty20uuW2RNЦzg)Y 3N4s~ iyZ7,y]v6>)}[]$WV$H5x#%[ȸt$pyx;A>i>HB_Ϥ[f/#w/Xn%Mz?:s U5#Ml=)J/޷TeL$RJ2ެRO3^G>DqECpƣ HED@ }iԴ7PVH")kJi6tydi[&|o폄|myK8/8瞼ן蟲? xA߆<6xwP]N:6iiXdijeD~hc(C'BpUJN2M4byINXz.QjQ%$MK首Q\EPEPEPEPEP_qOh5_qOh5<#%W 'Ն8DYD}Q_0W)wE<ܟccoGK_|5WNo XXmM pyfQapԹi^*TJRq4FMO^615a z唹)RSIrJr[c);Y&?>-0M7}Mo^[}/m䶋;KP4[_0cԠ'̴ۇ:ZJo4wB˔|*㚵! M'ZctSTquj.g58! J9O 痔]J}cԞ?g\|C"'yEq]#z.l̴ž1] g] "!j>*П|S_C'W/|I^}R'X+M;Lӭ"HѴk-#Fmt*?1^C}VW׊q\UysTtӊnIJP1WCK<+NJRNPJjJ2m$EWӞ!% |o)<~-_>FD -_w~uow}^N7iWwɵ}?P)zߴt~^#5_ Cy4ys(xnj|E@j:4=_#)b<&if_pJ9} fYNiJX\,BVSVnl~<UbSS ZQªWRk=Z(ޏʂ"_K+3'ğW>ey9%JUa &ՅjvM+TJF1eXx E%QBRjE*93N.Z.?G__Qq?j/*+ObKAT?E(ѫп:o?.?G__WEE x'1_p_&%O6ie$8ŀ>5WGQ@D/ء3YW_\be]}T%OJgm?|v~^e?k? \E}~3x?COM4iW[WiMfH/kMsC=mn!JQ:|;Qx'᷆>5YuOw2xź- &N/_g< =xB/F3bk˛|uh*q9.pe5*{,/tMFԜQqEW~ghj~'x^[Z2T;jGݦ;c?h| 7O$n P\3|D2h"Xn>.Ԭɤ0P*FUUPUT~ 7rSpWsNW48UH4?U%l4>uڶ" _ʲ#L>~8~ld S6ogѬ{>v^>rrךQhigkjW!^EkkIX] _4RZl/n` ?ʳwJ5#h/ab\\w^Դ1.+Pa+C҅jhT4Evi4hhB\>"W9SNj҄_WMYL(2>?oo.Q?uؾ|/0>oEVׁ)+}hBZ8.b kg~[-;~|l[N|| nt+X4 xzLO8Oh͸O3JyO֖*n*ZY_CKuZ]_bQ4*jJ*m zq|Q{-;ⵧ?W<|oR_cwKbKOZ,1d*bt>`mէGF|H(v YS~G^n5k-S_t񎏽"E64 SjZ%ܢTGL}& jʄ9b%Rξ  X+:NjIgN8Xpr]HќT4:;)h_&)z_cykQm<5ֻI?m|2Ak_k:Η.mD,QuPXx=2* lW YNզ(TCBn"VJ;ӄSPzjIJtRX7jեQJQvmY(#(\BsdH:]4lR{`YldzzvM_4  ,Z:ĿWW5vS|?UXՎZ;)k5cN][oOXۙ5o:X̸>z@t-b\!Ȋ9 {QױWGc>xDz*p5n?Hϋc'esv.ZWxO 'ItkRGa]8&sN? XP2Zjvi^~MB!|* d1x/yof4mN_Rɋ^J>P*OsMx{F:PNJʚ/+îb4!O3im1qBFeaΠֺSk}ugWM__AI0om* T8U4EUTPG_P j,y;?Ŀ <mH]e*mt׼Ivd;.e_Ű\ͭW0\DM,2M̒G$l+2dfjڙfdg ϛbx}r{^p*韙=q M-j6kwmwAeC9>>q^;=1=F6Vr~y!P=9"K/#u9A⾓ I&տm6͞EjO{._ꚹtyDVF#$qƥ*źO'/$u}]y6[#uW 䢼yI?cE6r鶲2<"1V#nF~nU}F[IBJVZ.?Q(MtOun?{?_}㹇zp|iyG|?8_o{?m}J~ {ڳd-[ ),O,3RO>cy9lk«UNIԒJ'FN=Ҟ_SԅiӕJ^0|kߍE%M(>f]0j'?BxUf?Ư_៌\gO}xLc9l 4Ok_' VC/5>_u3_0IOǫ*ho]$օZj6ƟZ,+5G#0G|ndZM[_u;Cޠiz[~̷M&TXkFݵ:'m3Fռ1})t/h7DkEmUYF\=zU(ףRTҫ B:8I)FqjQi4ՙ:SZSJU#ө )Bpe+FIvh(ȳ 37վ;hW-9U-f\vym/to`C~mk>(đ߇lvUHNc޾XrjjSAoU)Ƥinx\HHI~AEWq?Lϋ)xM#ú xR.fx<zdYx~o^dܭ$E:Ӛ*:7=88zWgd˰&۫;/QEO텠fCסle~sѹbEWŻ&~;g?@= ^n;Qh^bF_GEWS\gsowm#Csk!|rYτ Il'8'y5C8xOWOcKjnפ+VϦg/ _qQE}!_?OZk\,,]_+k[Y[+^` 3˰5 ǖ9'_/Ĺ>/78WF.9iTTyya;Mg(ʻ5QSQqR\{?̭Sox_|3xڭsywpKkk!.8aFw ~2FȚf bdCt"Gmq_{ȯ>!xX+[3=ԱVR8*XZi6RKke U*n ʬ~Ӣs2JuTB 3zc֭8u)UFh'VWۙn3ϊ|cM#,^EdJy #]UCuEE:pN*qJEF+S)NN򜜤YIͻWڿGys=?m6|; oyCX@GTgW|g)m q&aT֧FI%}?^MGMjJZW>jivrK/ .Lz@Hh+k/ٓDZ!*ڍl28;OK{wG88$ HƊ0QTv ;_etԯZKΔizg4犫0MzMRi}Q_VQ_,H> |*?xhcO7kUJ.l f|BPF Ы^bJrPN1ri&(kZԨENHR䢜m+M&SQ_g/ k=G<r?з'F8 #~ՙn4>P4ωu{ KK\۽q;JV̲(y!,GrbpVSNQXJQNͤҺ7^tF*7 )${;uQEjQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3Q@Q@W| i/k[߳.Vf'{Ldb5K6?hο5>2r^b*ҡJ ZqN 7yNiƝ*sRNѧNF1NM$x~;|l't_ÿO-v玶\X]YoIkK/u+ ~ sGxcLֿZ?jKC m1_ um_:BfN$𽋺y76e3?^5_ ~}_߇Gxcӡ4m&6iCo5ē^:Ϩj֣]]_]\\Ka3X¬eJy-p$6bm)mT%f~< VΩ<> T -Y5 7;UNR: t~4{BmaҴ]FNt2ROӬ-`DU@#aO>?5p<>Ÿ(|j¶YLnmo,6zޭϷ㔗 $x$VI,v%GEWQ_O ,K>~~'_zv>|2 |[xn[ 5b<wgŴKhFeWR aV*1)ZZ!hߩ뢻= -X 'UGk.HZ9Ti[݋~Ec C?OO?(V?3t΢ #6i+V</)tTW.+Lj:~ QGBçua?ޗ?qlU[:**YE<Ѯv, sTUEP@> (xkLU!D/ء3YW__U?Srҙ[Ot%|dfO_G(M⟄/tkMXۭDžQjj NT>/X tymql>Ɖ#\Eyo^%'¿Ͻ^ u2͍SYcΑz#:ũ3\6Is\dPi*V*0oOi^F{qGn]p :\MXӋjzΤ)AJ,]K )o 3ǯ-WER ( $:"ZxY5x!s,VqsLd8DzǙ}U:0QJ?f#G.8xR(w|ޜI9No'(γۋGDx@Y|sᶽu BC%Cn5M"QGmj o7{/u-W6KO+n :Z~ɨx[xYo5o79ok۵=OFi?qE} q{*Cnu2_4sI(S RZ^ZUG-b!*ǖ[/5bӅh-ҝH]smseqqgyo=ݤ]Z$HOoq<2G,R*PW_Mk77_OF|o7#m?X pi5-Q|~~Пi}ߴod|`l ^|>֧O]BIGr[۲xkΆ7()S--l2]qg8w)` kኗիZu^VKgh2@o_ h̚xD/ؓ'̼<#_mMi_*J/oƟٯ5߂_jK$Vv< ?b5޵ZYkVAtn/-eL.[9pfmɫ*8rܕxi!3L1XdQd)j77 5ٳ '࿅|2OLETIIuӨ|4 h)'7|Fq-G;_KukyZGSxF5x:ׂ0|'"MqkcV >:ޑ-V͕u7 9ÿ'æng|Pgx7?jzFZxt |<= xx>E,>"? O-ԅ:9WnMhէ:j'RyD _n=RUf4^ڍO_vYt? [""K]KwP\i:GkR?$(( 8`4bE(BGQT8DPTP_*;xŗC_iiV^.vD"sՍψ"յMUpjQKiNy'7\JN18]i&Qj1ڻImᶑ?ğ~#x# yOzlzCӦԇ)E#|K /|!V+jl$$IehzƗ8mg(rJKz??Ş%Ӭo>_IxŰׯ]Vp=)ү|/<_5o-k1;w U0BWě/|Oԧm5i:Nr x\rdY+ x y1ﰘL6i48O,T_9}R|_ %8MsMNT$ӏ:]KI.w[|5Α 29+TSh"~&O3|L'g :1Ԏ_CjW8ڣtl\zke1/u.ZNvY^VMom}2#yf^:Zw0 ビO9F4???6fgǷ&V㼿1_k]9x\~u_2.XinKfQm=J|xŶ0旡xSTTmO5': ҍҥHYಿog?j(|WKź6e׼iz~9oot̛m3?5#jdx_"7[e P \藖4;FO ]hvVjMk-6rCrJ__U?G[߶^ %\Ii:m=>;Xy߇tum-A줸ӭشJpQCS5U &aڍ L竀s\MT ^f)fi5S0N.e*я SOHR6')_> 9OWų?u˽CW<O ׾/L5>?xO_<[^F,QyI7~|/.we۽|6ږuqcȡ_Z/t7¾<;&B4=E]vZm0U (!n;#;="Y..mnYry 8\eXbʾib1SSUQQ9RHEFa҅EFӓIt:r,uRHB">V4RsrfҴ/?௏?'i~ @|) ;_|shVW~AwqY[at E]SIkmJM4H,↓< ^Z7>xC'|Y5RMk{i:A1\[N]G=vfž ik(ti$Z,]{s4@a5~~&^X|3xv/gyÓG(xoMiX$NJo&P񆮰ε5z"EջlO16>޿J ,?R~zF_]M?_q,\sz}gJ_)aI~ \vRk (# ? ~(׍bzO jlIZgV]~xKij?yXɢD zs]8JxKUbe^\+IUPljh(fZ8 t9qn.)*_?qc{_5LJdC<%L0m;@p'/q98z)uR;NjkU~ \.lxQ~E~EWޟ4Q]jxRI[$r*r'5GGі̫+) A pni(_uFRbߢo9*+KRѵ-_IԴ;#Ԭ.]j\623qYM&i֩4 5M>X(b> IwcxKE^&?l_u HuXRқW~(K[ URJQoE$^IK+Oi=_%οێ?0_ ?:Ϯ|G~_B ( ((((8PRS'Wš8PRS'WšyA",YU?>(+9Ɵ*P{ ?<]=e?5)O붗]iΝ&CkYZA)nL'^?.ׁS>:*u)Y8IppQjQdM4w=\1wq,FIJ2RN2ijng: F9%Ruw'=rK̥}Elf4̿|GgZ?_`o_^x30+} ߳M"Heq}c. _TivY[iMYDY}VV'݆"c4A ErWbq-% kn.-JUKxKb":ׄz 볳kNCEWQE|X~fmj.-.`g iwJֺEyxwOGR %GEe:УW^%V":iV:p칧9(ȫViԭVJBu*N[B"9?(6-Y2L_">_~~0X_ ºlS$M IOn5wm6Pr\(yn7$'V'NJќ<EOb-uGeEWvr47$xkT_O_Ǟ-Z +[[zi}_{uk*w]MQ(eE2Nū45{ II8)FI+4iL"O٧ #xyxSEf|kCguyy.ƺZ%W~<]i><' ̾)w^:M喩yI_?3mkVլiO|<|;ڴg|_."n󎍣FEv-u_hVń 62s>l֭lDc8l&':te*{3_|gCῃmG~=]%{@s__>9(}cO$gt*bsȪ{s8vP(L?-~? =j:G>;ŧY~-ҵsm osugiq<⮗c{;ZgMx?P>^-ɣZn3>|Tmeh=v߇u{K+-c_<7tj xFd7|EJ>#Ҽ7x⇍u5=$Y|S]kEf\Wz{)|?}~"UΕAxRYֵ%GX7u\xℾ& V-soj:w\v?!1us>#=b>6N.u)(ӋZ*jYU0RXL:t]F3noJuj+5Nq{U ^ moE~!L4kBm_tie[hf<>/Ǒv[^JT:R[]8(/iBQn26z ٦_iE٧ѭ{4¿ S-G۹"̹4{V̹h4S!ycЮOǾ Ŀx׋WR  ~О6ukZZjVn4E[)R ?')ρ㼾iu߅~>kf>$|94?ٲon"9$mvz͗5 ߍ9|#fYMZWSI{Y{jIo*e&yR#a[*Z()(8I{HO8'4ک?GOڽ (}+Bӣc<{;Ty~S}ߙiOo}/zuOeX ydcӎkP߽' su [ݾ/̩b4=0?ryw9|Q@$sr׌̸<x\6@NOZpK[Ky~{[y7oN~!]U1$(S?^ZrI'ԓ%č$Y< )?zX? o|+=O7uo)m'--ƉǮlϤ[Y_j%F xL4J8O'a&l?t~6J}7ǟωm>"E>E_ m-/Y6uqxJo.9M(Y*eY//7¯ j6ƽi)ڍ#Nc i~މ-JCfKEg}M>=~<co<[[&_׵CW5 _W/u][Uu=OQPu 乽yn.o.eIgGWy+-\Epż^WTZh^XL-(R̩ƬQUHGPጢРctݽ~ztWTIViM?rX;A~¾k>(Gi "h0xď7ë[g~"YƏ _X׮a3ew_>|V1O_ Wmr =+ eM}Z'ֱ j쥖Y^jNƿ Yo  /kl_}ʚh̋/ueJO/K3^ g_ip[0҄u9GKI}Zբ)ekJ8 LkPp3>JҎ4ս*Z3>o~ c4|{'ះ-<7}(--ޥ]mI5=w[gּA\wkzxsw+^u$c4Yp_Rt@=˭B =R&Q5_jURuNuj֩:jԓUNrr)sJM&mS)408aN+Ucb-4 k^[&Ҿ~ 4-Zj5{ő5cOCoe }Wv˴ ?ֿ)d9~:mL=\)FyGՄZy}I{45.y+ aqOEU!Z-Tҳk]Vm8YVUA9 {l# b^?)fg+WV vˍiվmo2XtJZJSյCZkBw%A'jgWb??e<[]c%o|B4;=gI+ x2O~-b3EHP%ֵ1\HDHJ4n|-V񏉾-j;–Rxo:|YT禙7٧SSͱb-P%Kδ%$vE7x] )]JszoM+]OA`g#?p7k8zo=$0S8(E>T+gkB]+Q3D ص־ ><_hu M[GusKӵ2J\ڭcpR{KH$6=+4?iO:w~ 3K= [-kI3sy$v7~͛XYK$6o<%Ok4hx hmeݞ٤[y G"23J^.XTQMTS6Qx.t'NQnK.hM/wߕ)+ٯ;5Z}oYhZj02k+ x5$iMjzTM6N>nJ.4Ok?;tZ~Wm|Qy۩ (('.f2HOv?|_{xGZҢo"͹{jZLLH5``1XY$R6h{~~mlӂ<.*dPݦqnݝC\O>'/<Mp zwmf7u$2FOGE=s * ApAAҿ ]RRn,uKk;'.-CeDua_C_}L'B~"vl8}%'nOF%F;=%%N"w:ϯKM잚;}RtɭUݞh (B>T+2~!2oX>G|eºΝzBk=OLe nBb"|i;iCCqr ޯȥBN2e'EfviOTϺM4iMjzѦa__'G7BtW WOq/8C*_5\.(=qoOg_4߃R|:n8|4>?(肊((((OCKaO_ kOCKaO_ kxGJO 9qfT0(`ۯ7CS )׏f__nRk縻I^%qAr_HOj(鐢((C~W_#)b<&<*(y1_?j(ЯG |5#~?|L__uqh+u>?~,o_$6qS-զ ~'1?((U&эU}\1)?BG5u|> (xkLUOTV?GIAET,u j?Y5.!kڏM_x?ro4?(?l2&MQ_G_,.?Cp_z_W2!,䠗?sD4QE+(?uAcW5+[>!_.o?R`cXOSӥo A#E_W?4}ծ;TG.r^|B- \ szsN帱4+ pW9?kԇ5 Lʥ׻iږ_&+EntL;~WZa8`mP G6#^*!9J+z@>ȷOZ_lTPhHּU#nqG'¹&waxG >> Gѥφ'pʇ`hhpӚx{/rNN:%M'X|ZOeK8F3_)B~j?h~,)ISNӢYѼ?Cgx_A{iVm=X-EhҧCJ 4JqJ"SB)h[#RYʭYέIu*JSrܥ&mŠ+ +Ri j",VfkKFҴ q_^%q-$95S/˩,]]r#խ' rNӣJM9_\TɲxG ^2b *\ьiQiBTI:WU?i|_xCĞ9Nc hwuĊ{(@Aa_8ӄ\9FSrҌR[IugJJ1rQS$oKV|9}O' 6o>~2@N K3 4>|Bh_L#?Ec YoI//S}9i_Mu <5mq*-O>)B-KYy?I9ibMR)ZqzRc%F:xҖ:PPG]SdN2V)ԌV_fTѣJɣץ1M.w%FF P}z~ni IbW ; +>94wJ{_w_|0lմ3Dm|WKi­-ޑtgSN_\e?^m=gkhxs"ռ?z kK$xQ|)? oς~#SC5گ>js[t캍_sgp<*?^+ YeJ_MWz>4UmR"gVsQ9^ͲF6UJzޔ6thIIjo'Ĺ|2xOS/ _2a#DƝEl][б&[)5K~Bc=~'|,m_ğxk񮅧x iſ- qevv7Qwg<1E*.;|G|[^ݼiV>yX˨Y@f ꚇ6/ke ER?2]*Xn%,)N{J)WNOaZ>zQ8s9sX ,-Yƞ&HT*ЏG)SkG'=?׏_bx!=q_/*{/:ߋXG|TgH̸?gJpNG| 5ؓ+&߳|!mrF~7 q;A(q/ WKrYF2Ӕv~:c8m{N)UɳrpI 4ޟ NP?,5˻p$$k9P$^Z/|3#]^|FRAv'ă=ߗ6b4c?O p>2eڻZ{wn{j2&E𮙪~&h*j# !c3o8?'6JYxɇ퍝F*᭯1v߀"'a)V_)/Kܢ?&Wx_ ig'T[~%nO4_ 5x-ܦ%*4.?ۯ ~zNsF^hw$fP@x⏉^;8˽'L}xk:^?ಿ oOJT>Fÿٟs٪x?KVX|;E|EXC-=x_|U/zNj|ccPM BU5oTQ5]FIno/o.%yiݘ_5a3o1|hK/|=U_*y|ʤ&Z 7ӄ!V-PTeR'p*~SUbt٥s𑼔*_|ҕ6EQ7?|Q/:]cP|K:kԗ7rKs{{w4#1nEbx71? >g>6񞹧xk~뺽vznX+quws*E"g{EfZ:&EtmWĞ%&^auZ]EcFcך^ 2]\K0?D EV>4-t6?xoXu_]FfmuK9nWbF˸uHm& qR 74NZ4gKK3V븲b2@;'9S 2_{%| :빇"PG}k~z}8RuۿVw轪=9?Og(=}*(4xw>\Avbdb] f27.JHO ~%iqK%mn=i#mћ:-<v"]4OΟᯌ}$.;x"EW84trXA${?xYq2S< T'>Z*Y(e% ~_l u,i zԡjM## 2A ?_UG/MwxRhŵH$|6H7'cH{̷"?J |h6o@Mv !еAci-ųH$D%os*ɲ8RwT1ZK5bΓm.qVrM}gX;lSntd涰ofF-mg^෍~x¾0ahzr#Zj8Tncr^OW($I_RN(V8ԥR*P( nI'JrR.%ftkUW#f.|մ[k\8uM8 imQ$4*ҥ^֧ .Yө(IofӳI&H!RtNREz54~O mmbO|3QUgcZ>>ib->zTus]F0O?waN54ޓl͎Zܨళҿ( 䒟?E7~H+(~2rKI[=Ef*< CI_^|y&oê < .fUEmѦHQF0ӴG%ŌC WaT -PT`}e);rvWܤnB|;6:wOFK&/ yaVo+_ WO/x;<-\Rt_/Ė=ӷx5=&+x?,`GE~ø9y҇ժwRT&]DRg/kJ󷤜 (?ػ_iGx'RÎihǩv4ͻҞXa@~O|N홸/ûk{5/Jۓ& *X\2|P3~N-M"l*a*h@xy.!Л H2)#G"+ee`UA~INGUPVP}b3\Nt\nH,aeT?e)nRWg{ugsE~؟.T~#MrѣN[M1Rj;6}qUժS)E;5ti;6kQ]F?_~ I_qoOg_~m/gp#/!Q_}QEQEQEQEWi(~)Z+M~Ww ]?|E]4YG ZT$Ei4k3QCan{ym%BDGgYFeZ'G/8ڰNJMNP(Ǚ-N I3ß+Vgxeq__nRk&?>I3߁?J?'K_~^ uGGi:ߎo/x_ZX-jZt@ֵ=6_YLR.uT %9vq نYRZx%N1XZ!*B2rqʝއnYk̲eLf_*xLnR0%PZYFhǙ+& +t((+x}?P?!~7 j{[t=+_˦Ol<;h*cnF"hHx/=pse*X:xeM֗0uUjR^v~aJZ:jXU XiZ/jWkhG&?>I3??I2χR|Lrß+Vgxeq_ǧg¿q??I2χR|L澽bS-km>!\w~2A|I.sᨵHt9nOem:-oTH[ B~3C%N<iGөTc|n>wKVj%A^{7MasF+VRWuԥU:n^C( ?N (?^>o^%Ifv~f,g,$ܜ?I2χR|L濦8_ٙދ}`W!qAo__o򸢿S,y'nh&?>I3xsy p4?;-_=?Nȅ<5k*ꭍegX¶VVp)fX-mbH-RV(D٘195j)-WmEr1X+QRPWֿ-dU77 9q4~dydY%啋8,I'_xsw<\n'E`/Ƅ>{z-rr^5%,%|5_êչy=*77.Y_)Lі|<“g74Êe?~?W78/+H5Qguz}q)Lі|<“g754 yy|0so 5}e4/_ KU/"\iqGdq8,YcS ,irRx7>v˒Ni^2,XZo V% Ws*RN(S*w{Q_?W_c[|U|6$k\jƭWLfww?,I,#kj~,I.GE}qFs.M*i֣7'Ԍ\iS:j瓛vwFs 29:5!RtQT Eٶ8+#o; z~ɳ_ş hq>5|;'~/|`̐ͮt"I''7CIuwM ^n|M5͟3dWƺ=ȌYM?_|pQq-9帎T^\.)J񏷙7%w,3i}X7kֽ!J+/~#J< ,~1xXG ?l-㕂D>??M^I+;<!_0Wm"XxvZ`3<}]yyCAYUY_zX_ z}kKJ"h(S_?c"ڽoWWkQx$ƻmG灗N&|9Zya]'Y#~M[oBӤ~6H:O¿ ˸^[[Qo^4k[Q_qG\AĴamM'W2h8*4&FM&}GNK87 cĨڔУr'Ru娓h(ЯO-o5]Kla'OPƿo!wcűi uzeGRH$v%r~#پcjPk w['~#i0ФPyѵ :͓8Bb} S_ګ$2&;8iS-bѪ4|hy9^-c\[~Lf"uNiV֫ۯ DҼ3hl`4?Z~i˲OҴHl4t0D;cFxZ(mmmݶޭmY+$Z$KdQE(+b~k+7i-+4ZDXu9H`t=mw^$of7:!d͟g_F ~0ӤMS.L-rD5+4%?p~.pYcuR\jTdV%&xA,,I{x 'qqW{*r&G+]# 'x&o6~'_:σF7c^OQY!x&(M^Oqywv#eX#o᷎>RωZD>xZwt72[%si1MĦR.m/Ybvh?~||g|,EGr F )V V]M8GsjՌ)7ZW%*乭L5s ]'IFl8/^ӍfڿڼC^ X5YxڳCּ) MOÚDLKi>CG@F\=zrZIѭJjӧV*BK$Fu!V:N#Rg JOZkɅVN~5YҼ;M5]-4E4y. SV/淲ӴXkh#iHјfQmI6z$նIn[vMշIn5]~%5xWԵkz֩s-j^5O WxZ xwM5[nct#K{BXඵI]?/h?^Ck:O>8"<1/ZGQpK+4v~am\Zi.muj׶z}_m!6ujŤ~&~^"Lz_c[G'Y,|O-=jIbҼ?5\[_`Tr+A[NJ5*-a%UqΝ%9=,O->jXJr_Z- wגw4쮥Q6oCO ~H~zVYGXRqxz3=y,Y;GL[ BuHQ_9wa[2jPݪTi`r:[2%< F{ά\jΤ칤IF*0b(+Ȼ#u+ ?DTI4^~UeA(Q}|{"쟴@;Qo^Rи0c]h_3 CQ5ir5TQaQEtQ@Oᆛw?Z1O|X[SMio ԋceWR $oh?U.k[o|{|ffFᧁm5+002hJ[]cw|ֶ0Iu{r\{;hKqu0˷5i%4 k &U|[E %xoK;ȉP\;G`3e.WidNSz*^S.7[xrz&f;}UBx/Ί(=_<7uOhVsI+$w]E.C0KYcr$@|j{A|z«^U62ӡ>Q>MMkkMK<=TFOK$^%칹Ì˰5Q+F=ڋjKJIkk=O#U5mJ4GF-ujW:}\Z] /̑YYx>MX]u&rֳ]A$֒IYmE'*_0x[O ~RJےkm pAqi,^Bz]pN^Q[]|nEaZH59~ q~Q_׿L29:w~!Z!<-xr/*?L |G񴩞V= #;\}z rK_O^yaoJ$ $2I=:g-MJǞ%ռEgint FTnQp:Ik?|1<3A'UW[?5dNHƙm4 V"]/Qe)Jk3z\=^ҥQ묪MzEEEh@Cj-h3yK *ښNe/jYvug`+=08zbsgMJQ[^\^\={^{&Ydw`  Np=LTTUJ1TT\|I+Zvu1RP?i̯e(ۖ2ٹ=~_I?-<[wzy_/az~)ʞ:{ƹ,N{GYC[m&?HmO_56$ X䍕5 ee`YH AW҃==rS.!p"# J)“WFJ\}v)s[N[_[{V ZUNqܝ~h mk؎ha[{xx&eheR,N$DfI#u*J _?? ..|oO wƺ%H۶Y47ZN+q[FkŠ03-pMsԪ%jS~zJ7n(b^_ xIjW[;ZI u<} ksy\űJԓ7l@/ V}?TԬ.sem gs\$ʇȌҾogq8ᦗI><0#cԥwk}$Ӥ9q`BZ^xYF[kDW5<$_k4o># մ T׆ǫ^7ywe=->3EFǦ!}{W.dVq<0[S/5Vw+?(kO&”#>rţxnȟDT{<gm4r'0=D#=SMSRTTr|Ta*#&~V/o^;?go KK),}v7us+4/Mct./Vzu}womQ'}+̯k 7U’^n4[sÕ&]U(JmsO޼Wc_<~Sx/pG^W^KogiPQ4՗L@r n6[PtN(1rSm$=s<)ەIy[Š(, ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( we[8 Y)I/߄<}7G_u9b? p`tO8 {=?ߓL#Жr-&3ėNuׁ8;Y?O<O^ _:<g5X|7\a>iWeK[X\o&I_tn*+*G/'Oa?jÝ]^G=Zq8$/#-co5;{H}_HCN*?o;29־5z LPQ- >Ĭ b,Uq ^OeZ2rmg?oa  ><;~m E,̱K}>0; ORo^hڏ~>'%햭a/D A%I=/KJ%ֵ]*[7m)?o?`j j( s./>+.d4SXҮ5u[gMi5}7R| ox$pd#UpY/eԥ:iuPa{:k:qzjPujV/G&O^G&2n5T`ZZe HK|$ҵ2ڷ~qi Y4i-DMW>DŽ|9p5gNO]c~ h|T~1~1<{m|?Mi߃<7h"/FriU qpj:ڭ$ԓ_q~e9))F-Y6NubR*҅ Oqy>˝T{%#҄Jj[8'񯭿bc~0|<6/a?s&׈'NM}o5v=꺉[S'~?Q CED~)z_Rݞ%im6+FYyojq/ti}[Kԟ+~_YE':|?|-Vۏxźц(/|UOxw8RfqmnfYXiֳ&e9vTf՜$e򵹱S^ּzaiI4Z1\5xc-mr1qڄdRON- 3P V㟊{o6 khf,ˡ[Ɠxz{Nk{;j_tQ_cqu&/5Z]'Jф tN#L&Q =(ӧMY.\'&97)6aEWQE/GooзaWwHmS^4Ks=:ି]6WMak9P&ԣϡuly!kˣͅ?S~7˖[t8+;ߴgُh/>EA0׍-u c[NЬ%#dL}C,-bcFU?ࡿOĺ%O~ZNm#\|HωlbKsᇅImQ1co;7 iףJ׼[zuͭly9l5*`_f^U~RAul,Ҧq=>0xkO|^:m-BmZ^mLO.?uG;'z.\F[:W:jTV)NTBJ҄'KMwG Ƥ!RRHpJ2JQ}i * (8[Ƃu/"/ =≴K\U,! ߌ|aokhiD7#t=2Z4jb*(TVMR!9ɨ RQMR)BU*>XE]$RmF1WrI&GwD𾁧\aiQz=i@Oxjs^%&qm|#5ٮ[xWInd$5㻟 Ez/~~!@dVvi3ʸׇ. ֍j:Wb-nSxm;Ga៌txkCtW<)/1/}ޟya,B0ķb`- \!>):8•lF& n1x4bm̨Tq^ MxE/gpќP.DڥRX)Fi OU)#/./i?Po_5o -\i &ž.,kxM]Zյ{_hշugVA~ɟ <]6G0AktoxO|ĺ<_i4]nŗOk{ ~+A0 P񯊾!ķm}x^MMf_?QuDU!,‰ J"">fx<' s,v&.?5h:X83*kj]9F7:#,%֭ሥxj2N9sj3N ]MJc: 5/g Odk:G5~Sgxg?] ]>b nuDziUK}],-_|+o|m&C&Ug=.-[wnT +Wgdžmq=73}~ot_|`/|3ÓxfU^4ɧNԯѼ'=f-SH$uH]UІGF A~'q6WRy^_ ʌ,NaM•u}MRtR|G7Z4kF2/x{%aX]UTpN:Mq\?({7RaacXiz]ivam )oieeinZG0CE**h C1O91JYsGN-w{{o9 @}7V״+DSioo[zb*(ɷP/y|Wܾ̑\_/]o>-nk<~2j.[hY%:p/8ɥu,ҹW04`n/~ x7Q43OZA|@uñear#iAz5-?jZ+wS2 ~'k* E&䅁]T[ƽ $p Ғ3tMTJ%T'>#?ƄaLx+R%.U[-V% P?4}hLF4xC|:3Ίk^\|x ]3l,>l^Wo2V Z_c^G^_hS2J[]> ᖡ31<*e+oS??QZD|f_į~>Pg?"_J<5xυD^#񝵦'џ[+CLK[+ s"oi7VjZxOF% hU/IUaq%eY R54U3|!K#:Sc'N))MUcQI5嵣(*Y~*%S3CjsS N콿n{4ǧj<9~~g"Mc]ƶsX"Mj/,YmWNjy"7|{%b :d|LM֥LUgӮq̖\?袊ఖy j-&j7,}pݎe8bʤz¼>_M Eb-.~|{g(sm 9;xVy I–^\ֵ;6 Ox$[a=^߃4 'ž? 0i5hZ.m?I{];MO K;h`~XQnQ^ngfġ,[.Z4O ˆэ<664)Sقp9te7z4U}WZRO(ࢊ((((((((((((((((((((((((((((((((((((((((((((((((((((~)#!| Q|G<ڸ~i^$tu_1ŗĹ;95{='ƗzMurjQG/  ;?K x~*|/NٚnuxOxA>;_^!!𾿧 G.n#-%wygf~-.Oo? >%^\T[xå<r+S]=~M]'⿄4Zl4_Úĥn3IglZo=WZY\n&j\% J-l=QeWʭJPnKq|ofTA`!Iįg EZXz5RjTRr^.V՟#Iۏ L -Oma$ .K,uP6e ߌV~uHgԭMS ݯg? I8oBOM{QH6-VHZom3FGYÿAFxkMk OӭbRV8N[۬WrsI?escu>(_u V] ֵDĺHzNLb^ѷ|[ -hC4΢N5Qi֧NMUiҌ%ZiՒoYs e|m:aNtViis*qMnI;??a/"'Eď>7|_[_ Z=<g(:&a/صsY .ek?Ydֵ> Aƺ_ۡ_ |[\*̈,< f6ZNKSu oIGU>/>U5 WT5m69/Byo-.bX7!(Neif4158Wqh΍,,2n*Sٯ eyWKGS V(Яʗ,ӿh.DUO]Οke_ ?-!Ed_o겿1ƶ[Qt|&mCK(IJH¤'Uw#Zօ)OXxZ*#pşj?MȓO㧁|EмQWZu  G 7Tc9R0jO sͥ_.xTc֕j-W湾cjf*3Vԩdߖ*pQFniҌ`oS`40Чv );sNssRV\Ӝ'dIQEya xk׼=GWS>$׈tM_B״MVK=KI4IX'GDeb+~3UL~jg׼i]:lK\+S_ lAEGڼI9?c{AB#A=A^-xOL=WUoqۙ+U\iҕJS܃὆*.iT$_+/iJOi]8FqK k++n-&EI`TIa'Y"ѕ-7[t:fYxI,ZfӼ?V kIk_S5XIӵ/Y=Tn~~W#?|u{c_ nb:_>Sڋ3VWGR4KS-(wo_.]߅>=K4'tMBHGV4_7.,AGTov1kc.S)䡍R4'*t\SnU9ATՏ"UcO a 9(RM;UKZURoI´3)A//5σ.¿3?2u^]qYYw>#sî d_83Rj剿ga)QQZ'jUٳ\: WU9qi:ps邨jiz6ZFX^jCcizfo%^ܼvvVVswuq$p3 łBY I9$=?Vja^{t?xO_/Dm> k+xfFn /~SK25R0x:Us ª~}jWg .J_ÏƬ$NXUV0m"Х W+SN?yjT)*tf_٪Ua-^{x]4sSQIW)Tbew͉Uc<<ƴ\^"L^:MF.NzT҅ +KQM5{Q^!Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@x-?>~syma-f.#ɩ[6i?F!.}[HՒ-%̧(h׭NZINj3*涕:q$J-5ёR:Е*VӌԄg BIIM4cMjS?G@KƝGǻkwK!iG–xL`\G&F^xW>$_׈atٻ)BA_xow+yg KEƿ*dZMܤQ_e^-f_N4150?F~Mz'Q*}[>39.n2J5uJ* t'J+G~_?gV/XypZ迴?Q|/_ij_ l[Q<fvoaN?`/o.q>'q" i{O*g:Z-̐ɬEy9sNi."wRP06n:#/N/snZSBQZz:v_ G^waoV.  xz /@φ4?AZm;GѴ{M;MO K+hm^5E|d֜9TSEF>ԗ8ҍMZ7QO(_GT.uʠ?zvJN͵ܷmQXQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ endstream endobj 21 0 obj <> stream xwTTϽwz0tzRWQf "*QD)  EbE Q{@QldFJ|yy=gs{ߵ.$/?./ '{#~<s P +=KE$^o{4+/ 6'%<2YSS %(by1'.gEv3;8 v[="ޑ-q~6#"JqEVaf"+If"&C]E) \3IKnnkˠ{qrR9q iLY2EE6601PuoJEzg_f : !$E}k>4$ v999&\D\?xCw$0nt!dqys8|O.2./Qn+\j? Z$J'@5RTP"@bv5Bmrq? Sb#958ğ%@TT&{܁ ,` `7*A 4.(,x !Bd)@j6dY@ hAP%B)@ʐ:Bz[(2CaPeGyP,T&j#U:jGnPOh2ZmC{#щt> ݀nC_B'Я1 xa0ɘu"L+Ư]~ M%8B Ʉ-rB %H \fb98 q$C2 bHB.y]K2Cv"G]FE#[ [bDDMxImIgUk%$OJHHt\RNIHISͥӤJO`etde2y2e.ʌS&ŕ¢lS.Q&.՛L-~CZʆˮ=#;JCh:4oZ*v6L{/",Ǒ)"wS.TUWhxIdh&hjvkjikjֺfh'i~]CgJW^[wn=^^m}>C?E  ɠ`6604BFIc&4?\ZѦ{L{M?Y՛71152eQeq{ yǒMK:4XcEnmƚob=megSm3 2E+h[MmY Nbolbd?Tw)giq C2e:;2;i:&9?w1sỴqsz qt+pwqst1ik׈7˻{gO/7ķ߯`r7an`fA'{C(!!M!C]BC ú%cDEDFFnōFG7Dϭp_oDUL~JݕW^]*uՙXXf8t\D\Sf9_?reg=c;KN g2!$a*!qotcRY ו[}\&% HBjDjk.-.OIWM_>a1i/soȂVfu >pp,{YvUۜ𜓫WV1XsZ_Cc^~ j7B7voܔib[[Rk[jk֮ھ7iUgd%;png.$^1힠K\|׹+]=uq>~hoa{kpٛ7/ruCˇÆČaߙzŽ{7?@?(x(l=368q~0lRmqb+N> stream !zExifII* (12i$ ' 'Adobe Photoshop CS6 (Windows)2017:07:07 11:27:310221 rz(HH Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?歱eD;kT{Zr.pqfcypwmeTscKLAkp.?wUszd50Z\pk?N?K_sUeOH:yLQ9pkmfQYgʷ۟\ŕX9./Zc5Y*w?WBbcX^nXΡ{kʿFfAkqǿ"gIo3\[Y5vݯKyװobli1FScv_۹/oQkmp5Rnq9T$&w~r޶~Ym(g"]5oj&ND"tb.#`ֿ%Nx`aݑV=f,Sjmut76>ڽ˿au7zQ`Hoe{k k}3 lRsv21[Ud9ͶǾ}Kb'"@ՏːE =K;ͥ+\]B*oeUzg?EZj\ΣS1/mՂ[x{vYcMfe~nV&udk7(=cu$)S_&gO=7if\I- w}ťX1[VH /sjvߧuc=_HŹ{E`l&w;}߽V k 8$ͻyn_Nn&5#OvZ:Oo?GRCE.[v6~o˞}{?UmkƉk\8'{}O׿ⷧe dծw-_zmQE-X~Hk;6Qg\bW 6k3FƱ-cka߲7gg/KQf4 s ';`s_}^?m}׺UMeRǵqXչbJtE^_4YDZG ~f,y\F\][>jmnN溷lC|[#b98P1 i3Q|ضmvֵ $8n},[)qŲ3NQR͕7k?YtK+ue8졢ѱ˾BA`5cޖ/pSXd,gܼy~os1ieWiu՝fՌ@t 8^ #;%db6' Ƕ9[4Ldr<1:X ڇ~Qp"g~&-ce[WHum7{.8%F"FZ~P /Ro;N{`y vICC}@Zpi??#\MkYm{\7{w3w2vAn@FOA`5- s k%A9Uw6齮[NJL"\ :k4>ܷvuwUeRw;Ҵ}?;ceoW^iDuHd9TBچܮv=ﭥ8슷ngg jN%UUli2wM>M_T.c vqwv^~{MzT3Ew ZGۯѮ7ݷݩǮ~*'u;23FEXѱiOfnL[{Mpe=g&MVgǴ?}֗}:+7J[ݑS^\Xr}̭wӯ{?e6"Ş'e.# :UqĹ :'};?{ص>ar22zV1׶ٲӷ_vjNvFUz)o2\}/V0NS1ǧ`e{!GnmiX}F9=dǐ ǎ?/ ?/>DbbxxUSN>;+c6sQgK? 7ʾUleVC7Pҷ{?Yܫsu.ikj>&;oUoFpYgѰրs ]D?/$bpTɊ>A0{e=KcuϵӋfc-9:Z3z4tǻdYޓ*qJ)/]],eNu(6~|Ǭ侻n-e=P^V=;4 =z|[?o& wcrJ7,ޫΛVZ*92_Oȿ)?jm"m{~\=Nab`ddt˝W/V諒P៌E]nfOVqȦf-H@L|38cǓ>2'>s.ʪ2Ⱦ}McmkI6[pvױAmS]ljqKXsɠ7EWM֯a3U=+QwV ϊ?Y) cR˓>cu zeٗ1q{jswp0u}/D6یL,4dAkM.$99#U]ԪeG* n$2Z+c]OK*|^[`۷P1*2ؿ7T!lk+gh9t[Kt4̃x[(a'Ba?9R~sy NkUp D_G|iSdfv]]={OVXƗ " .&ne62]K4w5ݘVηHZlZ2s22owiJm{GfDlg;Y39nvMޝa;oݟ"xv挌]NjQtaϠf0VEC;/'䝗 >nuE@m oVl"kiRvaQa8Ytc&m݈u)UPDr)HKdqsz%/>/1(mNVN}w{&qcߦ]ou4tWmJ~qpm`QZ_ml,j~M?/'נ7[U"o[zLUh.7}C-zih҉z1e8{ t2/ЄFQdeqXǭdZ>Ulٻnnsp6/Ck}}N6K=Gc-^>PUfp#{M-"qk[mgj[dtf!?\ OC}ζc>!DޖxGN 0ܔEd1O<?>g# fSC>oPE.8̳MҺ:L6⾻:]L1YV^}k#7яӱk"1v-"(e;E?gui˲ΠcY]8/x{Y'PC~n&< `>L3O,CۏG_M}asX%Hx/-{kUk31Ĺ5+ 1sJ'ܧ?Rvlݾ}Uz}.GY ˡ]}{w {#y2c" ppF,rF7YrU޿GO=#l}m8 &6fb PX\LvRi vꢕiBjber$ݛNey5.ͬ+ nյcjc+k7S[;}u[׻&2.u=Z .wvݿzmedcnWks]+}~_Cf1GeT}Y>m6S?BPcO'n)p;ruB;uX0Gݯ_MBM>a>F>v\f +D_d1E;~'wj4U6a@;6I?}h 2׳\݃Zd[l,{pI(Lp,uj[Ku]? 5Ǿh{On1řmL[:M9:鸖!mw(T1{ysg3egd3\es}'nvOx^#┣()7=7,譍'Ȭb^ݍpVƱq}2MmԷ!.%mFYoVk kZe6\ZƸ<sw7#7"$ XŚz2>d:a,̦?OT,oZV?Sjۙѫ#=aӒ}uu=_ -Ⲫo9nA .$9I$ttg3Y({|fr LJ>_|bbevh!^-7R]V2s ݀mf\ rGw;a%eX\*mooV&IQncX]Z$Ǘrg Ť%.pd==7"p0OMpoQ`1tv؏S6[Sݵc Euk}EߜJSNap\vzkݽOwKQG]85Ʃ~Vew^S۵0{&5Lis`${Q]OHDA?)W{lp'l[a O\ 9ϧժx-/jb`{v;on"i SswvvMQ *>EZIݠ^ _!.HyڢنZw*5*v4{}e2aZt8Yp`+oN Qa59Okr_oZKƈ 2w?wXZ?q}}q>z6~%"Q\ZoW1s^Z@L81k93CDD'%FWZZw~>ԖFRmoy7vh'국~64' &xClNݓo~aܧSnUXzvˍMmo#Bʁ=zgj5>Suv=w?fkz4٪#$d"HC_V[fM,skwSk]sckSgsLP֗V_0 l>&5f4o}{Nn5#.??ls6KNmk w5ğv^޳y'v?ҫfؖ=rl7mu*\)c}*jUD=jlgKWnNaB#;_~"uS>_ںuV1ݱsmc+w&ytNߝ🽽Fhqɱo&7b !kZk~u]w-sFo5d]o!?dovw+?C55w}cW#QK.B|cM[nsK֙wۑU~UYMnj-#qk澿oOm[]3Y3]v;g_ uto7ngW?V'?wR,fVZm y' \7g/"}[{i[[T_KkE\wʲv;W۲"#Ytk]WpNJ7y:ʋ[ـN}%3? c~I]ߣ{]{q[Kak0KXݻm^1}luMs~o!:fN'ow7{~ӻ/O+"vz~}6?~('ژcoNW՞nnM{k Y5Y_ @t88 YvWfs= z3;rt{6q :ܶl;#u#wyE)ZPhotoshop 3.08BIM?Z%GZ%GZ%GZ%GZ%GZ%GZ%G8BIM%iꮁs$(X8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@R vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIMHH8BIM&?8BIM 8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIM_ ConcreteSulfurDioxide nullboundsObjcRct1Top longLeftlongBtomlong RghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong RghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM 8BIM kȠ Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?歱eD;kT{Zr.pqfcypwmeTscKLAkp.?wUszd50Z\pk?N?K_sUeOH:yLQ9pkmfQYgʷ۟\ŕX9./Zc5Y*w?WBbcX^nXΡ{kʿFfAkqǿ"gIo3\[Y5vݯKyװobli1FScv_۹/oQkmp5Rnq9T$&w~r޶~Ym(g"]5oj&ND"tb.#`ֿ%Nx`aݑV=f,Sjmut76>ڽ˿au7zQ`Hoe{k k}3 lRsv21[Ud9ͶǾ}Kb'"@ՏːE =K;ͥ+\]B*oeUzg?EZj\ΣS1/mՂ[x{vYcMfe~nV&udk7(=cu$)S_&gO=7if\I- w}ťX1[VH /sjvߧuc=_HŹ{E`l&w;}߽V k 8$ͻyn_Nn&5#OvZ:Oo?GRCE.[v6~o˞}{?UmkƉk\8'{}O׿ⷧe dծw-_zmQE-X~Hk;6Qg\bW 6k3FƱ-cka߲7gg/KQf4 s ';`s_}^?m}׺UMeRǵqXչbJtE^_4YDZG ~f,y\F\][>jmnN溷lC|[#b98P1 i3Q|ضmvֵ $8n},[)qŲ3NQR͕7k?YtK+ue8졢ѱ˾BA`5cޖ/pSXd,gܼy~os1ieWiu՝fՌ@t 8^ #;%db6' Ƕ9[4Ldr<1:X ڇ~Qp"g~&-ce[WHum7{.8%F"FZ~P /Ro;N{`y vICC}@Zpi??#\MkYm{\7{w3w2vAn@FOA`5- s k%A9Uw6齮[NJL"\ :k4>ܷvuwUeRw;Ҵ}?;ceoW^iDuHd9TBچܮv=ﭥ8슷ngg jN%UUli2wM>M_T.c vqwv^~{MzT3Ew ZGۯѮ7ݷݩǮ~*'u;23FEXѱiOfnL[{Mpe=g&MVgǴ?}֗}:+7J[ݑS^\Xr}̭wӯ{?e6"Ş'e.# :UqĹ :'};?{ص>ar22zV1׶ٲӷ_vjNvFUz)o2\}/V0NS1ǧ`e{!GnmiX}F9=dǐ ǎ?/ ?/>DbbxxUSN>;+c6sQgK? 7ʾUleVC7Pҷ{?Yܫsu.ikj>&;oUoFpYgѰրs ]D?/$bpTɊ>A0{e=KcuϵӋfc-9:Z3z4tǻdYޓ*qJ)/]],eNu(6~|Ǭ侻n-e=P^V=;4 =z|[?o& wcrJ7,ޫΛVZ*92_Oȿ)?jm"m{~\=Nab`ddt˝W/V諒P៌E]nfOVqȦf-H@L|38cǓ>2'>s.ʪ2Ⱦ}McmkI6[pvױAmS]ljqKXsɠ7EWM֯a3U=+QwV ϊ?Y) cR˓>cu zeٗ1q{jswp0u}/D6یL,4dAkM.$99#U]ԪeG* n$2Z+c]OK*|^[`۷P1*2ؿ7T!lk+gh9t[Kt4̃x[(a'Ba?9R~sy NkUp D_G|iSdfv]]={OVXƗ " .&ne62]K4w5ݘVηHZlZ2s22owiJm{GfDlg;Y39nvMޝa;oݟ"xv挌]NjQtaϠf0VEC;/'䝗 >nuE@m oVl"kiRvaQa8Ytc&m݈u)UPDr)HKdqsz%/>/1(mNVN}w{&qcߦ]ou4tWmJ~qpm`QZ_ml,j~M?/'נ7[U"o[zLUh.7}C-zih҉z1e8{ t2/ЄFQdeqXǭdZ>Ulٻnnsp6/Ck}}N6K=Gc-^>PUfp#{M-"qk[mgj[dtf!?\ OC}ζc>!DޖxGN 0ܔEd1O<?>g# fSC>oPE.8̳MҺ:L6⾻:]L1YV^}k#7яӱk"1v-"(e;E?gui˲ΠcY]8/x{Y'PC~n&< `>L3O,CۏG_M}asX%Hx/-{kUk31Ĺ5+ 1sJ'ܧ?Rvlݾ}Uz}.GY ˡ]}{w {#y2c" ppF,rF7YrU޿GO=#l}m8 &6fb PX\LvRi vꢕiBjber$ݛNey5.ͬ+ nյcjc+k7S[;}u[׻&2.u=Z .wvݿzmedcnWks]+}~_Cf1GeT}Y>m6S?BPcO'n)p;ruB;uX0Gݯ_MBM>a>F>v\f +D_d1E;~'wj4U6a@;6I?}h 2׳\݃Zd[l,{pI(Lp,uj[Ku]? 5Ǿh{On1řmL[:M9:鸖!mw(T1{ysg3egd3\es}'nvOx^#┣()7=7,譍'Ȭb^ݍpVƱq}2MmԷ!.%mFYoVk kZe6\ZƸ<sw7#7"$ XŚz2>d:a,̦?OT,oZV?Sjۙѫ#=aӒ}uu=_ -Ⲫo9nA .$9I$ttg3Y({|fr LJ>_|bbevh!^-7R]V2s ݀mf\ rGw;a%eX\*mooV&IQncX]Z$Ǘrg Ť%.pd==7"p0OMpoQ`1tv؏S6[Sݵc Euk}EߜJSNap\vzkݽOwKQG]85Ʃ~Vew^S۵0{&5Lis`${Q]OHDA?)W{lp'l[a O\ 9ϧժx-/jb`{v;on"i SswvvMQ *>EZIݠ^ _!.HyڢنZw*5*v4{}e2aZt8Yp`+oN Qa59Okr_oZKƈ 2w?wXZ?q}}q>z6~%"Q\ZoW1s^Z@L81k93CDD'%FWZZw~>ԖFRmoy7vh'국~64' &xClNݓo~aܧSnUXzvˍMmo#Bʁ=zgj5>Suv=w?fkz4٪#$d"HC_V[fM,skwSk]sckSgsLP֗V_0 l>&5f4o}{Nn5#.??ls6KNmk w5ğv^޳y'v?ҫfؖ=rl7mu*\)c}*jUD=jlgKWnNaB#;_~"uS>_ںuV1ݱsmc+w&ytNߝ🽽Fhqɱo&7b !kZk~u]w-sFo5d]o!?dovw+?C55w}cW#QK.B|cM[nsK֙wۑU~UYMnj-#qk澿oOm[]3Y3]v;g_ uto7ngW?V'?wR,fVZm y' \7g/"}[{i[[T_KkE\wʲv;W۲"#Ytk]WpNJ7y:ʋ[ـN}%3? c~I]ߣ{]{q[Kak0KXݻm^1}luMs~o!:fN'ow7{~ӻ/O+"vz~}6?~('ژcoNW՞nnM{k Y5Y_ @t88 YvWfs= z3;rt{6q :ܶl;#u#wyE8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMYhttp://ns.adobe.com/xap/1.0/ xmp.did:BB1E9A8DBD24E7118FD8F4D136BE3175 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$f=OKQ[E;1WʼngK2,n s\q50@W||]=܆߼!M P: ƄJu҂W~[7ll%n akUIj܋ţeU.DS:!n-xF$e2d=ei 3% $9\UzH1Ukr^ˁ=qF&u`VA9XB aQP;mɀ>Gz{}Z;@Y^>ٚjE+tk*Y4S ;-ͩw2SDG)(nnKg9 yL-q7"x<;"zc#mBT AE_KY%n9J2Fy@8=A:O P1SFP)kۅ.ô=i%>R;y92u^i5ǼX^ۀ(Ly$˩%ٙ 0׹TXZt:SXȤߩddt3,Z8d5QȪ_ SL0-`ͤ NHsuZ򒡫]C; -XvPMA֬j„ @?(Fu]0|CdYRpj1ʰ+dμ]beO 8mssr #ӐjeUes^6{YYEW̡'g +'EKj"З8塙peM46T^3\<]2= r[Ȗn3-wk4--1U?g@֫HXƽ3{72$>Y QR֒&9~M;6\~PW"%=T(ja 09-` Ʃ;:&m+ٚ3wU YS+X#"#"VX\+dy2^‰5ISeSX0gN#D=ິMW( ]B!^:P]}M O]]滱& $R"/SJܓÝc y@ ugUsYk v >EnXa2 )ːDO0L+orRU`1KNKL)-tkZ69.cm^B#pOr%QUSEULߨHytti 2T:pL2Lvl7s~WapםTKYڻm;0,&5uMg"n"Y`w<eUM Im,wTjśPsВڏF>ر7]c"dx_WEYqYRR=܊㧅OeI4I$,mdh [`o \YV5OErBUp*:E{Q ̟S^DOmz*x-_@" G"}kQͶ.S*ˋX![6YEͲrA̋+%K$=|_HFHm4+(ÖָoZh@'/-{:"b,TͤkΜb~>`d%AxGWJ`N H/{ѓ܆F3vT\&YwW{*AB$x< hXfAdW9 c"kUO|Ȏ8$"$Wv4|"7%s,D̚y$U҃ӊC}m /V;:3w7"evsb6#&m x@ ltuesވb=΄cCʄE_61SƇW/{&I2aa'$zie-kd"sRp^X>c=G/(#?J|u8?Sd,F9"{9$hjb+RŒcэUxOTj#QtQ?*ys}?..#\w#PHQj9zrxxG#>d  &_|x/8ŏ:\hҀF ,PQ7(<,{_IY娼NW"S59O4О&\ y[)UUIb0(sQ3nj%>Gq9ʫ1~ڪy/xjxY CuXҬɎBGI,kZn{q:O?)"DkFzլ{ύb:yq:vRlw EQ'wZ,T_%N|kBTgMW9ʹONf'I#Qp_+ $a()ަ5 Gu 7 je1TiҎUzQh]5Ƥ'8ah`ѨUO*79TE<8Ot21 T0 W$?jƉ\z5]3 2;*{qҠrm$VmL[Zϋ]xɬgfմH1@ ^zר&7jjGoM2VMu,VD-MGpZscF"&սPÕBH4SltH^4LR{]:rI,dXegMTiUےۨn4Il4+D~$z8 kc.ˠLȤV]lLok-nZ}_ux:-S.bTnJfcյyޫɱhtύaTh[(.el:ŠzAc5 4&MrM΢U]v%yFbzۻ'\q\:+h-W$63#BI4( ݈-I[fk"qE鎺QY Otͭun]k/W[3v: &:6%ֽ:&e.FfN٨b.QR}:$ڶqǛ]sz`+6$9bɡZxo*dX cB܆B)MHqed`.`6=iPJB)ݏCvnJC{U7+?-`ۛ[`ojcP}{=OsCGIn\>&r\mOxv³h8ۘ91awO"Amj _YMex4f6f7e&ѷV`S]]7Tb Z` 7 g昕}l :68ue7]J83 eVO‘T=1ZzEt1c1?zIs?)rnrvwmSR +VC_BŐyq z)ٔ-;E]KNF: פ~$<Nُd6ME2&0٣bc63\`5|H"3ZGu/,.8lToeB]+(Gw HҔ_W+sqqYNb~GG ?2)q#reg ({Pz{L+l͇̋ N]˧s )Vtyށn}m;26)ʣuSdHXw\`rZ5eVezxm܉҂XeO$`SDA?5il6aٷhP!&A(t\hx0N;?[f9^9-2zɬ,F*|%udE$H|¤B5..|m`xv#I&c^M[q;'œ_YE\~Bq2KekՌ |.{(ҵ$12cVx]I\NVy.7i^+Pܷ6(/ٻ;<]ܫ:%u2W,Z {aed!O1 821+!ccOa^˥bYawPIP2[I\Es  r0BZ'GES8d7pʯ_ύEnVU3ۖ[)jG}6^x<ʡ9$^>I\㎀jr+ϔ_u(P#פPkN_y<4bܩw&sQN(ؘlQ:sؚT:*^S]Z D' LcUO4;RK9ZҏlϧCBEVWa_,l_3U f@wW[tVP;*S љ@j TҧYmgKAo a dg}'u!t(q+[.UAhbdSF.CLАE*Z٤Ձ)p+MOHL`ΣZ Ovmql$+ٴl[ .w8QVu_V5uq꜎*rR5s|[AwzCWNLE +7 8pFwb s@)Z0Nu<:՚_g/2ĭ m|J{,ΩGI0B{< wMEe=aV rsEA<25CHoJfZV_s8֛ɛ؆͵Y' ,)h :ܖ@Q[Lia9ܪ;:̰=w'ˉ2[&-eh`-+`F M,P0 dțr'6Y }L]BKUK8| .ƫϑ>n.A a" _EkR"/kϗs4UO.Q]ª#Q?%G 5 Ֆ<)c8'/DZ(?Ru\uqԿ/)>׷z(sx{HkډҜ|S6 Tr qr&-2\R9ĭ)n}XV)"9ʆkTmEN]^<*@+ G>ٯESOOd^|_/%75A%G*q#RbT<71g|OQȆ|zM*9Tp6I<(pRYX^"'CUyVJorx(Xl$CN?35~ȶFyak,!}rzb3Q:¹IʯPhuU{cS?`BG/_8N1l"ʊ+|\=!C~^Kxа)?Ӎ<_o9IǨ` MjHwR4LD( EUU^7pDrs×*r^9jSTBA?ǥmjI$X4'UkH4#U@ :Bp_T#+^yV^ԍUZ?˔cU^F>Ee~Ǐyh\cJ53ӔzI4EWrlCyDoʧ |Ie:'>22N3W9btXXG/[]**ryxE QܾIǒO W'|cp,ĴiN<60(ZT tw.V/};6v{'me%n DAj "ZTr8JEv7]XM#Jn,xQUd BŹ~&6ŷ=[CղvWb<ˌ9>Ov+C)*P@FI]ؖUkkdVYPJqCsGYQ,!%$g#|O#s ˓kd$s#73hϧ!YM ::LFeRM}JWmqJ4 Σ9Jy@ #2kSos X®cg ls>e;X+ Ng}k@K7FkWm(rE9ATdՎ Uj*!C)ú8 WPSmrnI՚q{VAӧ*}ws澬&њdESv92*Z4ˀYƾIᰏ[@fksp8t.ϳZǩnIOYrkhF &c,ƀ4PJ {UgnnwD؜&QgI}2G{hSIjk,5i"qy߶XY!U*⠞5@uh_N(?.|^&沴n'oc=Oa^.toLVv1JeO,LEQO),wmi˯)(^p5+ki#?>-Ŭ,ZsKHD U`sl; [lUVhmV 3;EKS/,dr4ГO>- '}m_]vńd2̧V92,fdZ|l6}Ļz*A㬨xZ K\d6* %㢛T=q̆xN3&EV+>C<4zWDv.b' dy&Ma(4ܱrx7 m&V 6@`E뾾(W*]="3#E,{UFd-bSj؈no5lĠ(pV1&P[.';sjPl2ŵ͠^.vV`8c.EE--4Ѱ [!:hb?^jX ǂ*]>$H;7."YcIJ) -{A!!;M݄!y Ɗ&fz% bkD HSUdʆIO ~Am6]VΥeP*Eb]u 5+3s dTɱݑUY1{j+ IÐU NEDD5u>`0Ybfz*{yˍF"pJO"9%#;&[IH-L{r vğpƮkCŇs\j+5k◙+,J$f[SY9/2 e„mvޤ %Z zc2O1ĩå6H<[Օ|83)]!${R/͒70F"#q]aImmKM>PV<ǔnʟY_ " E{؎j5,vίT2NQ&IwSNJPfճl[.#r<1ނ;l( N]y@kcO+fw^6*f%Y 58)e"&?]Q[@["]l JmַA-~oJp,ٰc> g0ryYpEbHV0Ǎ YXֽk9T.nK4]OPh$PڐCsV %ܷYBJ× yC=AUwi52n >V-}N祙jK܆NG'đ4a81)oeƕo\U9 lwӧS6kV:/F9{,дzu+.T>3]at*Gӯ>_E&Ť08>ԭ Kbk5Aόf4qi^ XRR>`2"&9_mO]WNl\y2aVβH%r*ٶq˴>eszc~s$Sr|9]_p8sC=*Hm%zUՄmDRF3|%v2d$"rtPv,yIEcGVO[@-CZJ&OU en-Smr,Rfί²UlF[6|ʹѝP:J,o\瑠CoptI9QZ!r|VPxE   ӭ2YZr^zQbWێ.H1f MݙFZҺu NQEݳ;yxA-f!ĭG2Hfm*9-Kc''AFbad!a61C46ݬKR<XWihpB {]¢ i#v d@S0c[K쭋%OG%YZS*s Q GwݟSj{cCa;ʃfa:hDm6 uZV0HUk`SsI8|K#w,)dʛ_  b:Pf[:d^DV=_')܄1Cv,b`P#AEQZ.TpeobVTrU$)PQi*g{Gۖ,q ݻ Иwi4e%F7Z/(m[t:9,5tmQ\8X\//j+*Vc;,LI8^#"yUgkџpEX{;/$[A}kO`x$DZ*)1WЃς 0wH%9-U2jSPypMՔ]}avis4غ[ ό&f{/ \ 0BDp?eئayke~9r:\W M<ReW! TpqHK+֨_ }Y-f32"R"VrA45PyI"M@hDjԑRUo Z]^,wMz,EkE|%"prKv&@Va-d@G`Hڠ5sd-YcLmWRzIq.~&j: ,ihcXؔq ҉4 E+qcʽ`ǘEh})N\;M{3|oҖxgqzt$IW`Q~z -:j>j#j `d V̞ΨXMfxʮFH͇q*DWIm@liaq jU5NwEƖ9K@*YeO. dZotz 1vR$-H9pF37fyTzOYp})z[mjD%=DL;疌ɇfY-3o1Դ— MIX䮝'S_SQy xza]Eэ&5Nhp}ִ=xa3dX-"uj#tɊav5=&.9V}$N QGu;r 2UUEr5\'Q[:sHgƱ{QUH֧Qj]^'b z04'*N8 >qHUDWըtDN" xgO<*""W9N~+mZjx҅+ʢ) -|S5ۃwg%FEFV/w*'|9bkOuTqV!3Ic =CrN<ܳcS],O6ʫztDNr"r~^Hy9` ?oǏtQ@HuUEj䨉ԬO??Bz؜S8WrOj_8ֵ׍ .j(童\'Tb@^Grw/bU29'h)?8~>Q,9>Iome#$6(Ol'jܨ1:S*tu);z+r4~~j&p.'p;H5I1k\E5p=e"OR+QQ|5jHJb<yxH Ӎ_oO0,Y#XNrɒ@Xǵs_|gZO.Ew N\F99DOß4aqH$Ux[tR TLgFr2ח"/8oJkESkW<`G#V ͐{R0gK/ɨOW/K\TUz^Þ|l& HzWD`XQSy5𨊫;No7oty^<§(5tЏON4"5'R9ʍF?4pYzF||lG^U\T98珏sSkH~~GSzZUs^"wrc{^2(1>k%p]P)g Q`g}25{̗'pՎ؛7㬑`6̅vއP90#Ǐg\չTBGz)겠hFѻS$,\lH܉pdȒKkqctCʈJ 9ATV|΢òaRJSfzC w$^HsD=Y)cTs %w~LF^:>=`(ʮ5OQ;O kMxt<6޴UssGH:$Pv~>ngOwnwhΪNIubWdо#\Ę#0 YBFho9%uQKu_ߨ$(!xlk'YCm|#[ cDp=a9tڛio<~NH 9(C+7JJjGo͓m፾RS@UDrU=JS׆pq6Fγ޻WҮֺ2u.?olJR {OUBDYdzFusuD8b˜ε٣⤘wSDq 3+^EO;Q$;6w"J Z4Yj?Dph' K4L}ڪ@#()�\k2Y Cu-ӫV)cUdg UYG1܊qHI,K'r<{0}|]݊U1wふ#{ %k#FV]5N02IT4崎[5ew%, @Z~x紎0el&}dTm2̤x/k0n!mV|mMO *,=Oxu#k={⹶ò0,v S C '[{ N3[B奝Vq G,I(:#j6׀qwֵE[ 8Bp**̅@Zi ?ON2 5 ~lmmw.Xbq#iaZV`ƒaB"gzmn῿}v5}7So,H5+K :dIÛ mUɖ{@H kU1VbjQqk+E䇍"D=jfS&5l>+1\n-}Vףpmf,.]Ug YfwDI>HxR=ɔ2wg9rqtmg`OfM:Ə, *Y*.W;F';K[C=. b fom*Vc"ذ,CuKv+<&2* +34 {v4.4W{DZoͩ cL\ cE:WNjd(qB')"Pf`m|% =$cXLv]a+=I!:NMmhʹa_Lsvr=\Fܾl u{ޖiXu:ʬ?J;V)ߒDDPRB/yf^o,mGD<1C>{dE1C*hNJo%oܮf#ȭ( iNJ/L*U@Ԑ$sVRAs}~&*>=f;jLbяf8P, ϖׯT#FW!L771xT{"x9p#N?i3E`0AG<^,Ҥ#1H3=<ܨ5#QP(U5EF= </<ʏSxGYH)g^aOkj DF؏15N:|$]."feMWWX9BIRf 3{^9y[_a7HPV[Ra}O^aQu8Iqrs=Nq96lz;r<#ucLeY$!;"q@(ޝH` ώ9b4H2}Wy+W<rᤊ2@vj<"+`{vB1rQ=-z*9^"A(FNV(,r%@!$Xc՘O) L)x)d@5 9%%A2(EP0!mKM'P*%(ln\;F#fWbAĪC?i^d6 7=lOx(-͖IPTPZ`?cTj2Vo{܃*fac]|+V>S""GW8 u#c5d1#qFS6<:Q!b-8xFDW*ȝdk8&_ RMniL ח I$Z8^j=j*u 䮒2f»"E~ M5C6D=)XVY1lgB3\|Ik@(0ĮNy 2\+1jz OGe>v&U?.4\HW=-r#ܦVm(VE@>>,{ױ ݕ@Aoi<-dsyN36}{S+c{k“JTNKgjE:&IKbjX*GNl8Yf+2kK 65U/+g!-Lqqc@FHx{Gd5ǹvUFXI=t o K!TJVGZ,@LL)e s /`sVS+v_n+6ov2P6Υq́vks[\}UF+3fZǼ&6bz^9Sܒ0pav0t[3 8:^XTcPZ^|vO5!A^ , \ت0_nIԪjZ89I:,F+,RjamvvI+uGc]gS5@#.F ɠZPƑRKOkp+}OsceA75fitWDtjA_(цXb aU\y"\eC'b/~{kӧORM;=ό3R[ی% n5u;{y?xoۛmMZ .5=!Ψ?e4CW]9=%5#ϓ 3$^\WᜢQȍmX!R4 GCZK`DV :N?ϣٔTd Uo^ـpUx_9_IB!FG1F9F_T^:z썕 z3 . zq>Ø|B&GbpW=^=ˏцPwIDl;dB7H*VOcÕyqRTE}UQ}Z)B#Uό#kZDTGrD_W:ow.UkQ[7jIwMˇ_\ۼI7DeZ'qG. #)59~46~-ЙZ)}okgLj:W~4rc:ME&ˉ~: m76~=R(ATSW\$kCE]оKr||iӟecVm)\BʰQۣmevVm3XRKE($n206pm՛[g1wYDÜWTH` 4I`x^cR1²9r2wdx-9f6>%bz{95cV;)!wxo-āUWS<Ȉ֯_pWJj,h9}ڼi^D{gp6='Q UO6s?֑:ÕxUTDNOƞ߷k^=\+DGcihӂGz/("FkZ"HFnkJTޗ"2 Z(}9)sU 'm ׏ICc%+"䗖=X򯗚"x,61#L玞QWɮb;SNǟnw2",${^S2BziP ^ GjjqLΝ:B )P7kT^]NysEFs\JKD*M@?Ï: b[οU|t'W\ʞiCcJENzN\$Tgxيs_xGRme̐h/L?[a4oVBkEUO%]?.x㎎Uk~^^~~95o,^ 1TQIʵ7ңQ>vh]JyFjjpUTN9DV<4j0j}xsP{DTTj=\ (:Q|e"usUtw_| :]/A9Z#TיW W7j=G4yUҼ78o<|A^fw 49Z򫓣EUk/"~>>^y˥W'WO^dtuZqEzka:{\sPk|_ǏaUUoENyrdrjCr<$B1:Urޗ+7" %T|z)xDt/U>WqU8_h&?qiQ}njfC{rGwy:UHJOp/i-1ˈ@ִ3WYZ W5b=/S\^|ucn9K,.Ϫ)S>cAUgh.mpx}!0Í!oqm { G9,fo .\زMCV+ jSovlVM~]r8-|Tu}LεyY,n%Gka#!|{),[ :3xec[1w`,̨K,bFVEs rkMߐؿ +2 xۓcaYėd(aXH$\Vĉ 1Up q\YDF9) zDsD"tu?TO5Ulm՜vY΄L:T4R T[c>UTƴQ X*Xc}G5FWy#US<ZӀA_R<30:y WPX޷9B1Ԩ4lOhf8dF+UzS|yO8=x,Y{Xvt'F^دC~79q҃kEObDC;%9O$|GҡR!ERiтD?CU:^/)氼qL [(-dkGWJkO p)֑{8^<:afHOC^>%9^cI:c%)`z@!la؀I?H V#FU+o*[lHT@A.dJxՍ*}c:YB #oט[jSV?rƬjKl| O].T^w 6CurSֆy@\eCW(sf@AZgzq2qfAEd>C%g' z$tyO8D 6!ƆU4w0f (-UdkN@)"JnHwZ^J6OY}A2smBdpѻ:­"QrH4A1Ya us0WJ=H}Ӂ2n6.6Uꍢˑ?&.W`]lV*S].%8{*܎lZ@Űi&01pxXׄ ^VW^Yr&U]d U5? 9> ÆM AאG+M?(;5NFljz;l|Y3E_ʺ0):B2G?#duA.5'|BW!$쀐dHFWTW\֑[B]De:F\s@*VrKnHwX9-UI R@cDzNGIvwy,WLy RaVyqJ˫ hy¼L&e1,z:fd˹R[~*zxl&pdCB|n#XdImYRX(rN~ܨ5SPy 4둶h$$ 0Ċq¨ yֺ7Fҙ>3m%aUm\wYOƷLK Gl̉}ʃ[MX4{l9S u"@Jka-ed!qȼ1 SG9c~ yyrvnmh'ԤDM'Sc'$/I'thRFJNJ%;B ?{&!uw_x^E ^A~øe1;*ʲ:ٕ54ѾL'v,eK#2I__s2(%dC[i9ǧk%ci,f\@(ØCAA΂5Mh}JTs,}*x;۽\fT}WwzFjx@[ICdM,B!Ajh>"-qlBv$;:.Ǜ,+MYe@#I.2򗰌׷}?LcX%lymj8.[GL/D 1{Pei[U9F%{ڕq\X 8qXqK2!ƒ&Sc=nZ[+rjGI3יb8.Dn!BJ ޺Pg)ZHœ~'tƧ퀹>զl_xXR1}odU5{2EvSQL)L(YP*J XKi,Ky'-@ZSCG s=-\|)m20O-&2 ?S~as+RE8 uo5k3쪱JjJ(ʓikju.$y<>Tc؁eKI[6.1TgV B"tϮ@\ d$$Efw1{ܿ4nxoO/h@Pr@=8=7~TP@9>jZSpbcKw@ݲdU1:!aV pC)Q##+~V"qd֣QxD#Q>Ew 8@jI18OB?ָB9#H{uVZbcD*9ǩ;.*'SW F *~ܸ%>I%Rw5EbWK`/DROr"t@DEw/揧];| d"f5b$GXч o n["o Z`W[t-EԘFܵ{Bd47;Y\/$s, Kϐ v ac*9QI0/`PnMKP`,JRUvz ," ֵ> -GtlEq{7"#eNc&U"mP.])o}#߶f4GjN X`y4sH` o|0Ҵ>1%BChAu'dѥaX;K9LuHA5;]ldY>NZo-;1C&}6ME_J|M&(NXsw?s+9UPE 8W9dxF)^8W'B1Uj|ս\'j'W5Dz|?^?Oև-skd{ Wb!w_ >T+yB?ώU> >?\.W#Qr/(ƢW_ƾP?YT }Ǐ!R$q;GJrY4h7v9W9gҪ** 4kP u Cև"=1GT`W\%NoSb+ܒ71zutUED漪 qP<)N_QBZ^2H3(QбrFp+WN?ǜba =3ޠE^NW_9;"=^O1CsrJ[@0AӏqZGcG+dBqQUʾh>('W5B++].ׅgWO>KϏs28F|hxX&s^ apFi#@)tRs74OUOEDxsyV"y/S?_h%Z9 Nj^'bU^cUx^UQυ#ᜧ.kkO2'yskouq}aq Fgg; tLCBAI;0_nuvUtJWf:@cǡ4j(PD1%G;^*TVh-pV8u*%E_M9j#U>PGX8UzQ,i(K#0I%xr(chpi*I# ˎSqHr,h`h!dht9" xkѫ5T( #!b8c!Tpu\#Wji+ޣοo)q^hkM6rlJaXV0YT%s8j/Z?9oTr+|9zq#dRJ"0G I@eȊᄍF'jsC5a!p\ԎENU4Q]<SIG90DwJ(!ANWƏ"ZF9ȏ5r9HǠQ7m:\v4SrN- qqK愌aH/w+v!}u5tU>XfZ苊욳nU~ c+10 KaK_ Ep2Ϡ@E\vs4i"b}*U4KW'4ᢧ֑jR`BпzހqJ:W8dt]M*ԓ=fE&KmTdTzrP Du \_8|=uV#|VU<׏ӧ|x8ruie{5FG(䟧 F $yF=\tw6zMwWJ|W· |w+ԇ4s\5^H1V#<|ĊmW!Bh 'Go0$N^gAȞ@R yO:Dyiα 4}o:9v `95*\"TN RZ4Z 1nTr|J&ȧ6K"d"OK顨gM`8fr,5e DbW͌W}yST"d+M:Hb aώ!YHVv9Q5ϑ׆Ghv,Ga1l@DeU&q"vf1$fSh"(aq $&e5]s$sE]8s` AHH/LUb+z1qbnn ^xh0A G:F8UXiԭ޿>q?gljľ:;C9r7crG%e%E^sXV c_ lڛaE A̲xs4TT3K&D:Iͩ,ҴVAeKr0\@**4=57")gvEޅ==CaZvbѝfZ6#ec u!ڢDJjl`Ǡ}(4oԠU7[cD vcZ‘If%-M&5w !^NѩEs,`D R)QI)ʤZw4mJ Z`Ó33Dżo\4%Q]TftxV_ՍSM%¶Eqz;"T,t2|~ =$gAJ4@NuF%pr~Tg>2fг6hR*(溔(Z <"xd#+`D}dX ZYٝ>=l]zq,wuFػm#0֖p׉{OP4T3j,y%nдv\>3ZB:1.gNVFtF e8J@iץj@H&y1k(-;5e83kD.`CF#ڪ[qqHbrk4Ҋ%ZPG?kN8p(и:8N)|3!e:k\M1-Q4lKi}{JiLR'SNPKl_KF3!d_d{jVҵ* 7fbS՚ZWy#Z"5UUVܮ-Um5g+}`Ƶ\O :0dq ;ϢQF& d}D[6t}RR@Y CrLIq[f9u1d8|G"9B*_QAѹ9⑿*y7x9o`uXqIj"^ȃ$g}ٛed\‹g4ljgd.ȯ#rm352}?"ܗGzc]uD0+\s[cXkDŽgHjx[{:\hơdcE.O<1*Az֜=NGweB^cλvƫ6KYV6uAعmGc+i1C4iǤʫDH+eopuZ좲,}lL;4{0y0"\B yN1VT%y f6xBjI_wvg>rܔ頯wl`Y4*zs*OÉ&Y1N͆pܳLijabwXʸ4=w?mE&!d WK7\8]]a;/9\ zײTdįd Yb]{5.2H^URDj8k0 (XAzuOf!OQUkˋ+wfhi/VۙU\QnϡJg;^壥n[KE%HĒtZbj0tmSTdc #)Q{n:t/5mkw ,hl감k UxϪO m6{f\:mLԲ4u+<)8O' S3sЍ_RUʪ@pL5Bf(ͥ k2$rE:::GGR!̎+Me9btdxPȎ$E<9O"49Ϗam1&EzZaYEeg&;x.ZgAѵnunW/:Ĭk&8zW:AYq&:#U=5a)Ǿx {yfw Dc:o#iB1G#H3RտӇ<+4/{{L.qĒOp/4<H ݝda➻!z!p7' ʨ\&at^W;a9!A)kee5?3FX lvT # :K^Ăptw<$f䴎.]Xf]{m"c*0x.axoL动oen7һ[)} \O),k" ZGtaH?;fW'd[Xqū'F} K}i̇}B.#Ǚnu'GԮQYy;yP u^jP=‡ũ2r ' G0K\j ?IsZAS>d>o$xj/ZWRpo#>(.Gi_2蠐;6p#5G#oV?{LzU,Y45ޫA-9lsyG"͘yv *dp,q]*:%ݼH&G 4SGcZ[⢲kHcop:p!1;hgbn@1 혭~̯hn!f_hDz¸x*#m[O}wNޮ믋'0W%դE_ʔTEUg'/rU`JlF_{\K 3HY[wŬ1Ir/wߒ'}=_n}mb/$mW3A=HZaYd2?SI:;MG/*1A"1CˉJؘ Cx\ֱޚr+Jޒ#9W+c7q~^x1 ZO*1Ws!; P^ffjъ+r/*0c7* Ǣ5j|Z&{UW6?^Hή*˅sZ骧jR39 -=ʿV+RCB7GLzF_y"5ǭ^= Z1\Qsj'!99Eio<6³XSzz5ZU64zq2YQcbRg2]BMcPjhޗ*'ۻo{w8ՕB8apӝ`hѿF ScQW~ 6^_u=G=rUz[IWo|%M3MP>vWG~^.cw>^eZY/'=Y0DkEv={튶[?vV.6)>]I~?˗Hkϟvԁ+,?{V5ȼzW|Nj~g=\Ư-_**"pIxбn~fZV#p2 A`_a .G1JsUsѽ|T^7+zhx&!*g\b8O]=#Up"RV0 h5YGRS<0{goa?㴼elґS6.llu*DR,珧M睥GkAQ#[,$-#-VLHu.ցܻGJ¼slhetݙ6)\k.XWϊƈ^QI3;9RH5 SF9vNHN|B]6<7+1L\ "f74`Z5SϤ-q=%UA}.c_0IæӎtK\BLn/lbtOIUcU'PhOw{gG<Ǯ3Jy ύ@dXqItz3(rbUH#PzX{||_$oNO*9*kϋ'KZko@(@P>s#cC\ #讎J;- ЮQ:a\^Zާ*'yJ\ޒ+ֵPM,{׫O`xPxL8,[4iL /]#cX^ Ӓ9+ܪDND_]J0UDj~_'U8E_cA?ÉwcAo4WDA毄~"7iQKi$x\e>=G&Dy%/r$~UXCʍDXV+0:z-Bf^|.WoaBCda4JJ }i 1N `׸A*ê4ZVEYaxqc8ф2M)PDlv7>^Ms[Ϳ+[]DJ Llym)xΓ-S+>bIfnJ+QNe+ˑcƎC NC^VXfڴۗ)[4˱]cނF{E520d()lfI )vY{WJqXн%K E[X,y+Si܄dxHAσ(QڍR:0QA>}_60 '5NO6|Ȟ^6= bCKDHI,a<&+>^?kQٓRLpgbu+;HV Ū,ΕEW nmkbu 33T03>!SA&E!{INnۨDpxU능#]$R{*ξ≥*{L~ 9ڤӗ+ˠ5N@|Mx![v(u+GsY^0y6^zK$!ե EcWd1va@ίњ }sz]`Qj++k 0('K-|a>$`:rk=Q\;,dԨj5W秖1uiy (Q1j)[U6ԗ3V&91W`,=5Eǟ4v@"R̅\:XZ^ 71%*B+s##%|zcf/FKRYf[g鲰Aܶ>$J}Uݝ 8޴^@FGkxܾNOO%k1؃gǭ<$: tZݎ^C_օduװ9f.Oi PSG5O!N:SG"MyP9jO{r}mqٓ-(5KEgG:VH3ˆ[8[ѣGhb.FJy, kRVdBFZMPRVSgc Rb%kBYNBAP4-U]cRVpH'J9V_*J%Km3g@ `v;oc_ciz.,|.̋i9q k6+(iò{"<UktI:O.S?9ipK˝,Bw֍"UZz7 Gh>=±%&\I1jHQ<קՆپCyOLSKx|3?bg)[%"hn;ܷi#4I+Jo%xɛ[ilva/T\tM$< ؓR; Pzl~up 'ExQ(dbVXtCǓ-r2EaXrUD܋L@1|QF48+ krאE0 Y&/-qt9)^+eo9/JtuOcPy8^9Gv{ FZ 5=Ƣ S*F2Ut /JlqYXnVqj轉 SE,jY$$kɔ[%VYȰ˱@c9 s;$FAi"DO'5F}C#^9 &$^La1"/{:8 (Q2@p/߭Xw1xJ<]77j46;TF&$>kx`py|,6(5}g)wF.V5$d*7~^ɅƨVMF^[Wv仱қa6C\s ks,*"1VH:m'&Al=_֣kQTʽ(~ÏNTN#0gC\UEFS~.r^?I"I CHA}^8{F"*||o rJм ](u|7O۵it(QV"8݂mM3ˌEFUQ_;6`5brNUʈ ͻZB[š+۾Fe1[G$Pz8>?EǕv];*?M_-m{)d $[ʀ4}p~ڷv5)q[U\Pe>C%P㬗vj_YB`[eTV]9Bج<#˓ԈDWXa CH/!ԟn{zt'c}ar1`%/dǻt_I`2#Y%!$legPc,r=t":XCFIC(G+ŵx G'[ l8|3s 'P\\K(iҮt|r;s+eP;{Da Y^IU Uk~ ߩM7\ˬc8qO&2ÅW>-t2;'4r8n<0. ދ鼌_MU:U#PgvWS@sϊQI r1`^f!W)ɼ#6Dx_5F[yOӟ/ 8y 2d P#Uя'[R8UR"/W0!ZҎ{ԜUb|\7>0HĊ%R2}OElb3b[7E x˒?rytyj+JTyКpBzx] n^ъcF7Apk[0!+*UU:]Q꧙^|LT4@thz &\Pr5QZqd#R#(ޔj"q =?˟s ֜cq6l8fF5R<3DkUZ$^zy_ryt'VY ;"d2 A@r3d BPca"q Fy[  )iEdDGpވ4dQI=^ } G8ncx^!56J2C+3O0A{xڹ#?"6ܛLnk *#ٿQ\D=(ZZDtYGk\ޡ"}23{9k\΅(Q2ϧw ȑA*xQȄdzj<$,acq FyӽU7],r/)ʽzSqн?/'Nl" }G8ă DP Ѐ, 6XrzԈ-R5Uo=w*ֵQyUxw tﻗ%E"HHCHjZX9'[\ѰnTWN龝tZŐ%r`"#e|Vt D_JTu?:\d DmMꦦznjG>9v2YNSՄ6F|9/hoL,Xm^rȈjxBz(I0,RNS`l$@Z*:4P[ =*xG~ʆڿmZܱZ7 8/?uNn8629?&`am+ا[[7kUE5ł(@B2vK<`};$pw| 2v%&L+Sn$+Jmlƍ!"0zSCʜsP?o}޼`Ϩ)$˺;xp1zؓ)΂ornMu{%z CHةIm|ʊre}V)}g*ֈj(&5kgI*2o\;*32U=.˧.0B aySk&p<__v{l_6/90;r=$d~7o!rʾL+C{;iZV̟1 Xэ{d8W'H CMNlN?Jzp`T̩ËbXk0ڽ2=:#z|[ƲSɴ!,21QǍU_% 9ѹ2qץ510nW1)WSxҧs< laU4T3B1O>XSE{ L1[YC+@J5`zUF繽+xR`O8 -ɣc?C9cA("0rQ޲MkPC^A2T0HqdIFs&ʞR7TwORy$X5eҵ9V*4QJQ5*Eyt=yTs_^.\Ʒ \ |NR_br].ͣo4 ]&U,)Udmk };J Xc8, ud{fPb{xmtf*4]ȑT{^$"t<s܈Ձ!P rʴ\rEou-qD=C並{|+:b[~J,wMSx)j3(?$yi&4tqb݊6U;ycGG|MviqHNa A(#ax -(dol{V iJGNonW i^tR4BxɃ`ꜦٻK5{, \j|_;C{]p b+ְo@EXmkcxTwkIX,D"Ee[ͶkjMcu\͓y|~\-^e ݛpl?4t(x䇺c,]bcō^<-\w!d_<9Q˜ѷ*LڒͮΔ y9T%S;$Pi4$0R9PS帵F)rt _jcӯ,nxa_;3_,:[*6f[6&ʫtMfYI1`bDj1`Uհno0Lh4塞|m2îQf3|Ư meEk2Vm|f;f@{&I+( 5$Zn#J2FWg0[֒dIidx#dG31"zpazB1Ov0`V]y˛t(xrGwm%T*Q*x;Iq@CrFIcl|͓qd.R1~$751TqXL_QWMc^9}xI$i=USO /e:UbM! rCRiRosE9~A0lB .-/ 8rm#,\>6At͝z1=U#THJ%xKyq PxˆM6G FMI 8d-ºC%n,c$j4OsľYm/žd%'iͥLR[LOr EnJʊ'nnǹon3w1ԝ~?̦m#,jnԵq>AC*d62Oe`~* 6Vb:ڕ֘gnhd:ֻu_ff?6 fX@F!_U^9+"zmA;ʹH@ɰ++fʔaCbs국V9QQ+S6$ A^ZI`0.{Fc>R9R=z7/^8OǪj9z\jQj?pBu~1Zr.6 cW]^uhȾ9?Ny*]?Z˗s? sƽX1*#V~kyWU>21EUAO9^!b"/Hc* \NZ5;)?by(I8'YdeXi% I qkPj8˜pƽ EsT{[截8w?>/RQuқHQOX 2-+,cO՞ B95jx8,<,萖Z#Q5+w{##}2Ako$v7F2ΏQˉ_3+ԙ]oX-mDQq bYd}J"xq ޾v_ a9_5g`V4$>>1# 1S6L1WgB*3 ;͑ۀ2S+@ (udjpxyn, W޲ܬ6uq?2R`J#Y.DLy *=< &+{68`%(y00j[57y}ny;rt-3Y݈42b#$`1X+pvuy،\r |Eɵ5MRіBkJU|VNsq 9<V\м$˩ aibɁzE ">\[{crlr!km,ֲJb,CIŎx^Y6{{ ) U)eKrxȞ=; DLb 2I̯޺Gd\ZVN+nj ;˙%5Xq Ȫ[GTS(ukL;Uy~Ow;_][RAm,Fx^ݪuݬ7Zыs$![IG/7߶SnafY) ۗ^hz:)D1w6`n}cdY2wl$Wf]%HP#",}~=pvy6P@q_ sD[7$9U:,j5\o;̾G؞F9lڑȗw\^\ֱ;EYٛ(y@T:r |om3`lqu'Fj,ųڤ_kn {#TJ; -/]۾WنC..nKa8$:.Y1-@Unc_LjٶQ0/32,^Ua5$c(Ty_6 ˓@TV~^,XUW7pLLUI ^,| QaGWå2TaZYLp!R#ѣOÞ8TQ*?5DDD|Mx~o^2 BǽF})Dj1b'*nTNZʪ5H3xѭFNz^Qj/Kxbi#R1Xc{kynma#g|CE>`G{H"R' Q|թ~ i2hX2Sߜ,"H+>jhYOo2YoNGktEogd rad dJr"zܨ%Q[~k6wR[-F{y,LQ,o0"4Us4[O۳b时5T .8m!w:#2<+>|!!,HT$/ Id/+5*z+o\'ɾ>I]y*:]|( &NyK 4!r Z"Gx|yyc9{mϘ4|hmA5m-!]S>I1vDY&=Pm%]e4E2JqƲXX$bW*#cb**LTJ*5E_cҁH_OÌRܺ} m,(wmCSpZEFl8I.W#NUFzqs*cTˠ8o5ETIRU;DPqֈ|S5H tץGmTh=ká>eyG2bgw9L'h6 G[6 YD_B,L94:#C0N0ް" Xǎ4Xmmp6aHU+.TDQ i-I0Jz෯Bɓ^c˩k,2%ɧ{LҦČiYMuRS*r|AO|Ҋ\CE7SD#rO.|] ]"8’ SB=C.-PU:Ӑ 5Uy)&AanŹՑi"G\}6sn^tr#rE{#RHF>a+g85tvp#Ŗ i؏jHӼe,M jA4d@:mTG5 ^,ݮOö]V Yήl_^]tϋbϥX%-b1 ǩH쯲gcb.aS@O\ll i1az)aFV;Dz\*Ai{ Fjt>ܞzܸAܒ`)Jֵ+tO㣌;uFbuye.Kvu|xWx㿻n:(([@:hTE[!H٤]Hj^r^x o[JL0qVlOgSӺ^uy09um2)֟L}cJS[U֤ƣe0ݝ#Cb$sOd巯P]拏׹bXVe,9.Uu*Xw{~XߴùH iWFl_1\zZFv?>SUTui=Ŧ=}ɅFX9XD[x\ITնy9 +^O &::AP KIU>S#ώ[[,C6 hȢ!aɰyb9hq_1Ya4m\=D e)sƌkOY}6ď  ܐ!J0KX7l`f#\Xʝ /w$}~<}~f+O FޢtUZܹyrN/bULk9WBvBXhKhا x֍R0I|VY\S 5B&J8gV=_US֥(`+DxXECAQ^mot>A '}by * jG%S9G n+ 0>]&LZ–nGdgKLdǹɟ!^ׂQkG)LP=d}gx,:Y5$n4cĐID$Vcc;!VK[ԿY$חTJ9jiRy r ?4wr@:44Ebt*񇣵60KlSL >0K,jndY 81TH[MY5{y7U#]ULrVz-Q Lby?GyɂwX羷RYd_ہn--Su,ry~?}˾)_$ZZYX݁e.Lj #de2Ȓd^}0ՏWiuFd3Vɮ64bn+kQ.e3mۧ|Vf:eXVXWkŧT" UK)) G98^US&;u\]"29kkݝ-JW̑=I-vo<Nwoy;c\^yjy'{yo$f~bBY]X,\3z#4ii5y]*5 >+`+*&ADL02#Ih1+QKĵII+T= XY[QUO-;)fiKU|֔LY*f^1}Nd29lM.-fgkGddڠcunr`[g; >}쮥Kc P"^yգfk]cԔWHqS@ϸ{l?O h$98] ' 8R2z*i9jEPscp<ـ x6gSbuACǑJIȧ6Sa?UG*|a_lp͡K*7ү;"@H"c4_|g/o}?KXQm/-n'%%bn4p"'j+d$e;[Tl'ݳf'Sev XWԼt-4E6*8lcQUXEܮT#Ԝ|rF x"jbQXH?]UOHoh\繍w$csO>7ܪsҬc[ʪyY<XR!5@4BPӇNbrZs~A"|98 +y誟27WNyRTgӁNs 0^QUsӂ jY?zoSƸr5ܵ*+U\j+xkU?_/`#IK#Ĭ#z}hs`\/ǒ~o/kGIZ F\qX$AhiCW815:ʞ7X!e3AIm P9JUIP /"E!VtVeGnq/ d(=$K:LYl+%%DOI IaTkՎ9CPOzY1==OLDG"n.{+Mp֍,H@JsѾu۾1 ,3EW u :JQ'.;nbݳlm{خeU8~'A69nf^ƏU)d0 X5R_y=5t& Kmqk-TƱk 5 &{1!DSbݗ)m!a4$!K""!f(AW'solnf[ɢXᄺ$*ITm\[վ3vGp%َ1$ye*!VQGpThm2ôԦl0rPPm |kSV:"2ʓ r568ꭝ2aapY<[QCUr?TTT[ Ӗ7Zf(y-wBs{IӘgЯ[:@ŵ)HVvhEu(bm `8{S\3L,XH.c_N.EN-ipف^"Hk^7ˈ䔗*-rHKtp̭TQC#<紊;o\}H\@%R!UCrfH QjSxɟCsno!3qH+-1§EH@<<ヹ=gAٸU;eLC,WJf36Nxv=n?a6%}i tc!ekts9el$QJ+I択1R5GGj9ꪞzQz]ʢ~x>0:}RԃkF*d%*4<3gJI,el$M)5'^#Z۳ vͥZlkIKPTe=|~K׶6V; 2+XwM~la[ˆ9#!тX6W`VcQz6hו*C-V@g7=(EwKScm*?Jv-|6ҶߴpoD!8m+ W}eY]ɗ0ܭ Y]l*( |j-k2 精+R5 O&qb/SAMꓠ55|4DH[ˈɀ)vǸƤ 4婺:N9OaSbel2 uq5iͺcܝ^ho$Tj7Q#օ+!H9z±/?}P׃A|x4W `5 DFзL2^4Q8鴨i.+v)J+^1Lau 5(ᴠ|\yT;:|'Rr joN}*yq*?~z÷2Yf=?Gd9TR/5.SQtne.묮TeNagcOWxVs XlOi]c9>=91#T\?ޑzuN7\1wjp[NA5v+X^'n9w=n:3,?2둊(Et2is(2 Lkw/k*yBdq%y{T_PJṼxK, *aOCNEjA>lU=7gC,8[am]+IN \6eU\ۡA1;Ŵd`Hnּrע<ȨCqvswo E1^{=GZq`xQiEt(CPǶ&+>rnl-X1lBܤ&mfi.J _*F\)G^P 1^Tĸ\bvK`Z*\h*DXqȶs).FѡZ"rG5ZGn?GF)RmWujS@PZqpJScEؘLrMŜ7פ}Me ȕU C4 ͕Mq:-C.+J [$]jqL3=W7yٌ¬ѠWZQK򁪔MkO dD@J΍BYR*7":$*smC]X(}Ya!`Sʖ8Z b2>ҁ%=&*%MeC-g9dJbH#"Ĥo΍"CV@yiZR :qG(* VA h G"A8%.A?!:ꎜ[NqiTʑ&Mm^xҦ[b=ޓ޺┃Go*Xj+2I [`OgCU*+VƱΥsGx a4+(?QP@ uIO ^&XRR֠Ԇ<9SHAx60"0|ZTW&c-_cA:Gl$t=3VU6aVUii*}[]RSX}m[A<"Mj:͕D]Ay$Dj͞(7XF)0i2=t«^c*ݿc{ܦ:oǵN8s $1rt7\Gg3/$[Ddxu &3o ]r퇏 /Rɠ422 V֔5-nYjxe "tXg;\F} 14Yt}9#ZrrQW^|M|^`l6Xx!RJ.&2M5ʪ\^JZbBIh,>cFi㶻^gIėG,WsW;ʺY -L~Qu 70+J^šMxZ{5׻óz!mctLl:M}Mv!ˊbǓz9ű\bP۬J\xy={,mj!oҒZ{Q Nq j8w0H5C!0Z6Ve!ҥMUqg0V[v%exf?.-^Rkvgh 6'ʪ2$5Q$rV oXkU=s9\tMw-{FJ-Yoڶ9 ;Ic'Yf%$T$Lᵑ簍b+\ ÉyUr]ޥ{W.1BׇgԙWQa,*95GvHpZxͲ]}qdna>q#χK>#EM0M|4b*#9b5(o;`-QYW%Um镱r֚]Ĩ*Xu=sc| vo ൎIom`:[@RUX5J]Kh;epKHmyx++<}:_m '9Oz9y ׂegCT;zʽm} e4̒IlPDhȃJ0@iZ'_\_emsqKaY1Kki]*.&i"PIQoopTt =uPl\㥪|hҕۙM]\Y|`G X|rVgb`UE3$c8/rTE/ _MH kDUg7#%41a ֙~e դ5j52ᶾ;tNRl=H /l7z2L,qsm=㌮NS-RICDxXnﶶ%a$ljsXOc:$ֺkW1]魪1 !'EC2a ^)B ¡;KSl^=W :,_ ˙,nұd"S6lm%*/EO~ou>(♖yZ`A>߼ x~g2k3o 5e)e3wǤp|udj{tv4p=d|b݁ef+#A, ׵*Nì@@loIX>K@CCOr+O*L">EE=QD9L{% 'QDkg[;$}q',ϊhWI#otGѶxǴo~y%i;. 1) h&cnsQF ǚm~fuUٶߵGo>foȏg 1zZ8V8ybJr#ZF*38]Ϗ/qQdEG*{Z;&&cWL"t+]eCoj:C=daN*(7*!|MWyr?NrNdux*D]%Ε_ !'b%`!Q QyjiL"'>oKw舿xWsE^_wC!X^rQwc2A'/_C:yDU_pqBxA3$TyQ4peƕf0iDPS< Yd(xfD ɕ]aאXwcRBXQ5VVRU9G a+n%*qkgP75$ڻS#1p_'m~AHmG{:!dGK&T*c.4]--USđ,&!0ыI"#"N=xlgwt+u_-ֻ.;eoqr^%bf#GW÷Vo+ ,-k|$)u668G'i{gh Kُn9΅X΢r32H"3ȱ Kd t/"UG~Kl{'oD!5AhAo%ċf?˾|) wsd#0)VI 4ydT1B$ݖ4bZ/䗵1n{!U!p\hI~#c&7qbpZF}-TU{'v'Nh MJDRGR&]̓P =B( SzqΎ/Y*$a!c%*_|4m{X+̿wۄ]ٚ$X Iʹ;"J${9UX>X\6c7 M%-.m&Ku]r6\{$kdq3[fff~\$6Y\`U(F.H&k#mwae5m=M_p%יN`SL<7Œ{Xhk7af3'okcma. usI /1'@G'Kvwgˎ ΆK H+#[DOIܜTIK~hݗ^Qbrm ):Ij JeO_o|hmaz/vK"pIpZٙIRu1"3d\1X {qW:=!hp#F HFQ<ܨY$xB\Œcx6+PkқFԮV\zFEXeqWx&İ$xd^RE*ӑe+oi{gw>h1Fl#3XiqޭadQQ<kǘ,o\e Xpi6bJ-@^iT1ҺAg˛;k-ƛs<9d_pDB#Z `;ٚl'aE11`F3( FlQ#0=~4k!=*5BNw>2KO0NEgKNzDN["""sơMAN2 H"$,2JemtE,2 (rzRձGxV(5+Y(w?YyB5S(_NT<RjVx$6]ȨԲjJM%+El&_#UUTDչa6ͯ-H)\3eر#Dقk%cC#\rd$[OĊC>R?x_QpA̪wtѭc YI]S֞ME [ DbѵL3 G?Ѧ0Mc;b*gܪbø)ŞŲL"כ c-GA"xUҚ]M# "ʽj'K ?UWr[4cE_5ð?@؈FQ=83urJe$ JԨ/<򶰭Ѫ:T44#-4흈y ZHԷ) [&̮ ɭ]-*9r/RN/df76)α +'1+(TǐI+ 2`C3UseQb1E I-!SIc)r\ #ұ`= <*t㩭 ☿cSV1acyQ,!٭/Z*2ծ1f#\^ƹK _)ƴc]fU>Nb=il[P[Y^Gu8"rZ=6'~yHZ6$V]GE:*M$s`NV:[]j@ ]eus..n6prCjB@L^75"[[JP vNwmOid *[e0F"KaeGzb|9iTQ5{G!@ЖE)πEJ t$5 c 7tZ˨z{\VT1ۖ`;ΜTRxiU !l2zbh%Mjۼ%A[Z1$2H%+YfE+81*ۨ JWWx4z5jӬr̚"mo]['r\޴vaIwdb\d~wHVqՕa^kG&rkRu>3KW\X/#R3*HEebU rML䙤j{ӕIVӍE<.T'54Np={a=ݑv>ͮꠋRcsunS Cq1Á]]aEkeVb*Lia n4+ƍiz~ƺtYlQNPCܠS"7`F$(Ztr >hɆBWFV'* =umCƶgk}ݺh2 ͩqmr+ף-+tuupc<S{x0WwZa ~"] d`E8⽄qB8{U4S~ʫC :4oP3v;O ` (jZ(jI/I'{}kͧWI ?+s.ҺfMl<+Se5V8U9'G,[dk# 7m*pKSm6U(g-KHs^9qIٹ@Wӯ*sbyO5 )^1'hs1ϗ9qOk|8j0|2]s3q:݁_cT± 9pjaVl)pcuϽF| C-L:Þ"ch1%%|HѶdҍɆ{CXXIrQGFIPBߔj4P8˥> nOuiS&ǹo݆6yk`D0H>` #5 YRYLrߥ*Q[\&E fzh1fN3Tض:D8MK06Ǥ|B=*S/ V?iܟd/4T?N:U"^ؼX]LdP"(y׎BtFQ7p;9Ynu閺ڿ~[Ĭ՚ȵR$c&IBGUdW]4 R_ƁgeXQXiŃ^98-1Y8nQW1Oi,vR,o+]CSȤa0ԥhkdB:4a!R+_Jd՚1v&5e7J_b̾3[:f߱KVHd$;[*.;gx\{0fú* }] t4p `|a=/*br=cuT Z7?vIt`UIYdqYHn(Qe z0j9^6QS݃=3 Ic^Z^vϐd2EM{ ӧe%6d*VK\! _dG kdth*߈WUXiZbF#*[x~T.w`M>ShDˣ>ԝVƓE =|V7s?|Mؚ \#RPQy⢻[3s%[^_ꥦXcI kd;sq*;!k(~!TW#3Qw#DD_"<0^`PR*d2PG0GkeB{nTo<;~~0҃&dD2OMcґꊌpd=TToLjꦣI`T5z$)^5H%X`ʲ~2$]ڇJWӌ:%sc[˪fF ;[:TqSWw_c{DHb?O_F*9dg17'+#JEpOgSJAWcp+] {lcs;g:ϞIݵ]*؊P}s=*ȶ޽vf.j23эjJП{PᴙkMW5hl? :?ֶ8=1Xr`71f42!Q)5{B[vUI{,C DZ;k@lþg7\ZdZ"Fv P0BB< ҨҺҞ>q>T2!ݖH"|#gZ Mk֣pxsQbY= EPdS ҅hM }w܄;䴱c&Xb5D~{In=I/x 7Gr _.K玖4X/٩Gxt6wcrFƱqpIx'}bHE3/nc4sؽ<ۇnb_9n H=O5F@O{K z=x =>p~$6]G@ pVAKk e֒ ).f6N"Ƽhv_K;;N& 2_5! yͧ-:<bI87edY=DAGSm].AHDz;rɊDj44e3\ƪq{c6/:;jS&ƅ& iVP8X?3ƾ%;<9{f uG$,$*H%əT+wI~_Z;by#ͽGpeu2Eslfmi(otN aB#PyvN\R+ }ğQÆjֹ!hXs Lp{U ij/>MYNRNj|x%Wafu dc>q 9Пccy 3`+lYĒ {(ygaĖMZ ;DV!vnE*7vϝÓv.GߞLQU/7 v;w$v-{"UHYaIbLoG/-=e\gE) ԝoIe2V?RIYGK;=ӆ띹cgSwo g4 lpegF7“e݌ޡp56D{20ڹ1O-Z5Op%q#;UC/M[|-=1N+d;[[#O=ApvZhX/f͐ŬamW$.›-⸍#;po?nl1.{HSr-%y _(2< eYֆm8{#XhtSX~eESSxOlI8$]FeرF(ߙj!߷vH/+#S7t9M$vq%>r_XK<}Dnyf/sc)63J-Xڼw}vw-6{PXw6MnZ8,[@\f& khuޔcCTԆߘP`V\_B+FMF/Lwxuxk\Gn2ȪqelJgv(1DK+U@썟sg=wQw7W2B$IQebfY٨ l'Dwϧ7ivsuY꽯Ơd1c][ŧXI6,F6ȅ4cRdDY]vkWYd ,\ ZC F%޾|$|67dqn]-M []!%I++6XΨ6=o8»7ʻ-}cghثl`_Jf՚N'^ a/lbβ'n,X6ӂ_m|5V`1mxE%!"UK*(*2̛o┺ؘn{kCϮ"N==pKU4=Bo$i:eg|\8nd%`-B e(~Vi}'׃v췐ڵY#ô]Cqexf&[;[kX{ #04zCuvwf.gK}Eِ8Ӻy^b83 eeDzKG=u*"moS&sUGԜ=JTs$N0+g n" =G+9k |+QW/l sXjZ/"F9sIb q_)ʬpHb5 sxzʮV8N USkUU8_Tdg*ǑK7 |A?A8ʗR G#ָra\·]5{;юCǍ!HSrV2\7זҡG"'ZPGQPdVpҢw#?>#3z/õgXc {6WE領uߘ-=¡O- ysMw?ݣdٔwVahdўw Jgd>n=5cī2Y(ɜBYiMYlCf0NTťu{fnxsxIYۂ>@f:ppzANJ]ό3Sy[l{ks/#!BL̀D4HQ}L ]߃gFnd[ 92Ք5㪞>#"3Zn5r/IתJ [#ʳ[[KnpDv%@ @+\/W|O}v[|dP؍Pu;n@q;7j2fMmm@FQM&T[|=Ìx-~3 Mf  LB*=0"9Ng7>MʼcH}*zq%IG!x@NLDo' ҫuqT΋b5XHYmZ=UВI)'Nju>XCZBy zGZQ΄W ~?>sY.kTXlIxwX#J(Y6Էdҽ8OK]U,䑔`Ł;5~챧$ܺ'5mAzBEF_Ӗ( Xr!*icd,lԂP9GrP粘t5kUj:):HCsryqjI_o/Z|}yc^8ffcVf4 ;в-0|,c{-TSOn-rl8[oO.At  Ki)bxDFV[6rA+>sU^sXMaV )ZAPqw! F)O=k;F\0}eEI+ ǍHl|-AT6ɐf fp;s&>TzWQ 㐑^X[>k 9,+n۪! 95?:s磩8C,FB O@ܺiך.a6EUmI Y~W18+A(&i-*{Xԕ9;8*.0 QP%y7£a⢶m3!ۥTY)!wv/f8C+ܶ4lUCM]0,j_`xV͟n 66ɳ;K(Rs]e69eV^GpxO.T'?ZKm] ;x;(MA1(9k.^c94R< 5uzp5J|ζ@u4=9}x%>6g F>!SyYYN,0XY'51]iGA:381,ζw4Ŵ,ƬgylgoDlmy+!`& Fr 3IHIqNZ7/"9"^?7z!a^?l}#]RK!uoiD7p3鼊qoq0ic"IbxI_O1}.yc;l;w,*bRt5yah%CpbѥɇVHI~'{;ml"I[>²^W JfcFD ݥ!x'Ҁ R tyG#KcresEUW/٠p+dmvKiyZQS"Ң ms{w|s~2M".Kae#/H㱂%DQjL~8~03|^kpo?q gU %cRO|"#|\d 5w4~M&}Q"H5W*cxͫmV:C^&9$?JHuƮ+;wԗ[a<=̐bA(+b xOhH4seZ=3+~BPQEuLّąsnGȐ_ugG{ 479Z·;-=0vZn"L)0Ґ\QC*XζG CR߆|Ws!{̓\O ]Ѭ2_f1$̊nQ Zw%hVfsE.mki@F#u[`S HrܜE}|-;k %9sAIwo TwRvhNxmG>Y77g$ YRdZc. lNQۀ_‡[?F=ou ~[eQi=Id|v McI{yBG1D;_vj>L4-YY_.Ֆ~)^2MW cPC2=\891{tl3nV ISQ!²F3k}oyYxKSYVsBKK},ʬsK`!ETU+eڧzy?oaw@cbV㝸dXY2ǖk1~w4bw.$(d{[]q;gW>#$Ñi46Wm|%"L:*9OW)σ,lo)edUᖌDri{D O ]mw޽YÅ2I&H7%..#N-FD)(E+Fw-²Jx6?lMUdVpUSb.MYaQS1Qʞ+k 'zg38Z^tIwXV@MŤ0$3^WhmIě-}KdЊG4i-mbbiC9˕ ~zCE H$,=Dj&P5<մ|-闱軬eLch ^iϲE)iHt []e]fnO ob3*k,x9VX1 G' _ʯ}2k+g38.-J"wTK@lI8! "ܸ;+ܚNDi޵ {1Y3 @8S=c]gqCd,XtnжV[e{[HmnnO,lm=Wݗ53+kMh<3"2b㺱ZEp&k ms2vE]{e$Wom$_5Hf1iJIf M= NJ]hsP!fC?v\DmR)9.^a/H]s٢h䴘}>XċWG_,cm nWI]Q*v3vSL;zNתԘ]~ePJX\(,r1}:̌VU'4M.[noȚw ;k^XU&GKY.OxX9"6{V>PxO+[G|lԯ/H㷄:ߙuHk౼?0{OCvn-?}kZYEqELQf:Y}]!a2)Jj[YJ1Thf\6ֿ񲙢ϺA˅6 +\d2 uc^$ɞV9;N!c'Y.3i-K({a\iǸ7G򙤭1oF#%UAe m-c csgIs@#;|L3\5\@VƦ"I l: VCuy4Q`z!ޏk=7wlEpdcN,Q#srhTi{_Xh/7xXc`DkQKKxQS,+$װ/۲}5FIu{ݵV~Dv}mWmtNQ]I1Kz:bdqZwoc۶ޒ"j0aV)rNxeC}fH338˹wnMs2]b_.d)WQЩ5v7lo[lI lYn%2=% $b! W>O%uc=Gn㫞H^5W]/fFIȬ H-&" TJ} קJ-Υ9,(*)BA0P\cBq$^4:Һ0=$ZTQUSD^<0Y\}2|]B"K~fLZLԴ %TZni_7D ^A2I_qūBx'Ms7~2DZ+3p کJk?gJ'+oRxژ}0sUDTUwyO@K#niQQC=bF)@R>81sI%M&!G͜ʵSmOecW$.s#u!W#Z? mmk^ J@䢡^Nb5c8Yl|s-6|F+r4-m5y$*l>.h86}dK.[O}ܙ#GzɁ]3 ^nF/ a5fPѫ@fr+U>)x.l&hnb20ꬾt?KKk[{ICt PEEUe?`DˏJKؒTȇv-:^ OF!$)HB}_UDE^<`nOGTsU֩{娈TG/xH%ǎZpEUI%AP%ԉP$g~\6#kX+Li!8+Z'5NDw)糎|/*W?u9¹lBkN 1䢵 b1X1S^MMo-3L`4ë5g)7Igl- <ؽ$5%Db#QT ^_ 6TȊQ¦;벶[*ac_DLr8kkc=57G cAϾR@JփG/µCvY -Wymcr (j%Pv)EeC}ayxcF;ӴjY=S 5hi+d̒F$ċ dlB4O|#T,Crƕ{9D3;nK"!$DҠ}FFdHf$H9qʌܳ8ɠ3>?e ;oq3b@lj0-as"y"*(X!Es]-UEU_ʿ>,ĎoxL5:N$8sgf=6eiFUÊG5<4}*Oa#q] |ތSqh劼›LхGV‹^WPV :pc#]IFl'aJ!aSPZEFIYhfrގcDoD}P*sP8D "@bJ7Uz6ch}*}?%^C5Bҵ><aKorYK,{2!#Pr3*[8fqYMylk|V(k m*&`wUwg0Ck:YEI'A5#"j-#mm];HFUɧŵlȁG*UoKr1?#cffK$8h*UCZ$S"ul~Sym!8@IUYѯInAjyp96*j՜%f.k<~Q0ޗ뽋 ,UU,6oTXN in/,>35lI Lsp9LpR^R|E|o̙0>Os:i3,Q'465C,:y#YȠF]ϰR$R4XvIn0^Z(܅4nG?l*9g&w_slPV8ǁʋsNS$h'<&UEZ/R\JaDY4AQh5幙3dGF* La%j贏,L] mJSS^k !xo!-eoFV_ X-1(Ic{$O4PmE!8c%A9O2\Իf]/nuH\\hy^L[HcDID76%N՛=^ek ^M~YX 2G17WDǢjy ̏`ΎB#81Xs?T :"TIZ\~8ucRTPtErx{\W b,Mb-k<ɥUHCD7"C  =ߥ0`w߽߷VVL6u^Du$neG"1䋹Ɵk]ai.vrvYM6\exO!iSF*F|PQOlyGqA >?QIଐEf:}.KMš$#^{1$TbTKbLd˗-uL9*Vޚu.Wox?#wyֹlu\K Gk $Uht!u DP}ch o[hbՒW`9Z8GF0%cA҉1Ѥr#sͻ`˶+mҞll cd"- 3XR;d!1^tuxyۓxbrbL}lFAg=Om+΁M} o gg{okfV7y!.؍!?3ܿkڳuȸ"e2t quᬗ4N"zI~Үc G-ilB$RӃOY>B1ǣF+ӎ`- J44zJk앪LJ a/ X\-[\Ő*CA&kUoTI:v*{9qWd~#I78d*}TpCwWKk R&<mh*j]+ ِkV,g"U>Hp+$sB}N\*ՊлY.۰7!01|Ŭ@ @ON~;|Xob-e͵lx3:`Auuk8GE]St/x0O%[']l}fZb'V-l).H؎A d Z=\]퍧m\ ã`Z6v#Bf3B $%x{ʬ(bX+؈skN6Ll͹s[{%O^YS$,lkx& "_)׷w#һf$'<2Mmqaj HcjtZƈ{h$nmј'>kO2>EoMe-~uMbdu̺~[668Pz3S6obD<+,QsOL{`f C}+B9w2;"1{wߎgOw|ЋA8̊^BuƲT.b =Qa9k&Gz# 7LvYOx,Ew1Fs"$$`I(Z&kʼn}}zlo>ʹm17wlזy4wW+as9R׶Be_2h8,طYG(bk\GL6dj29E_2&)%tY"Vq-d,` DHKW>oV㫄JLva)g>&AVH@b1ʣ|Zmgv(ٯ_\g,D,G >4Y-d1f&vl<߿P eLJn"ٞw7$jRT_&UmF`C7:ɦF;hĬ }[hs@dB;akwEvXnCZny@!}4LRsB,aYeoppˍŒGp9}2GKsiip߭ݕ1[^_/[J-Ō>W5>hf ֹ 射ۡ(jH LTof}oI;&wor"Aϴ110t]s͘p%FTKG 5o_ذ߹eq( bs'$1%k+6Yd4eiΨ!'b9%;\_dIc4u3¶34R_%SO. -J_[Mmm m{_"o,%qclFlZ[=I 26#&P%ݏvοzGIMwbe;N}o߇I-%}YeUX;hU *{o޷qxGv;YiW z`2v+ʢ1ʞ98w|W 'Km$l{4Q]VQLs#r<}}b@;`q1nL̙[B۴%x743+%;\VW([v7U&S&Ӻ6wU4h\0&WK S`ZM]RkCB:+gV6 =ͯHMB7{܅"b.8Nv J7]4Qmw5p%տv\mm}$X NZ]JRG »W:d"meO)M./p=fv)3ͮ1 Yx c=ʑ zW`l %C: Fh @[!DT9V2[I2Rޛ|^؂5ԡfjQ lIm4ES+V7+y,kK9B]RH7,mSgRUH d۵mF:FAZ3ɮTCs+$*"еRhcWKN-F9gSOJI@{,Q:|ӚEăU^m۶ܘ9ZXdA$,(LoUR NL~2Ws2F\Я~=[2[Z[ĉ\34v+{|+Tq )23)8l;u\8?cpcTȎTWji\f;sJgx~0s;n7y"搶r$dF֢xVk).mėWR*HU(DUh-0Tyxy/w<.'<8\EeE+Bc(K۹]\i[HU݊~;;Gu6_{T[>\s\,YVf.no*|!F?ard:z3[9me46L Z0Ğv^ΤD^9Bݩnݶf S{k}1A#Bۍ**l:>n] )&$ʊG2kbyEOh?x;si'9d|-iQ&g]][ILfɆhECQ ޱ~隫6ͬkM>`˩K/k5PkX7tiUW\|&)ev^g-r~QĶ9вw7G{mñ,.cd =#ky=x&xMvOhI@n0 #K7n--bgx^[MIb hڨEd{1 I2med#1Lg&}r s#\U_/>|:뵲s2ّ`)aHV`#7dd qF,}Pj @ރg|#p}g0!]aV!ռ*J~+W]XTWNΈBU/>1 ת"+QPor"**r_/–#ˑ/׍1Ðz=rc*|ʋ6"^X6ts×:/ȉ\5|}@:q*t(7_'sE8 gBE/oN9N";غc@-&L3 12cIgTr/ʨ+ɻljM vvhRG#0<-|g }ǽh[hnBDVH~V)]/mtm/n9k3MBUTuu%c,bl-BG8Fg + eLQ¯K`:-#qMW*d׷ydכ\DryTEsQW'*NUQ_!^oh(qAX9"f)ө6DUQ|ҝ5gTEG*NUj7>^ji0j!O^ t\(divF4hwZtB8OMQܢ3~£i)x6sƹ{}%\t|ķi]k',/IJUO \~: p]erź gh~XT!;(p0Exsv!9ɖV<5F4dedUbF6o]َVXq:?S[dZg81[`>'Adz$oDWtVʪ|<"WOVǭ1S,քVZF chP VzogJKZg4JñZ7"ut "+ڭz9EkW>(qΪ:q@)8״j:A1Dɰ@zFGj5WsWh4ik6e]\!r=#Ļbg"KF +ΕwK{ïgdpY[)LS0EL' z1/ʞ&#l;:{O&AX.|"t)ǂZHudAnstݴ*+Q>?uzx S0&=k䴙V&y05 \cGeQv7*#G"+\du-25*,L0YbR>SȵC~VP-c *ֆRc^Yd k~r"|ҬkنDmV?*rXƗ*DzI b<&B&kVrB[ qCQ2T*S*9NQTgZ<[M_uan1ם$`mqOӕxέC)SP2bvXմi;z UUNx+nɳXI[Fʨv6qABj$Orˆe[v|*n; J$1i,h н%)X0*"6Vv(vT]H>$^,*HS8wp-x:ݸ:-*1|E1Om2ڣ,%+D*zAUC4ۈYmUA*.,lHSآj#5FB#=ɑ#U#-GuiԆ+Ԍ=̧:{PtN|>9n᳕(dRkJk=?#ܿGe1]Zk.6}18fO%XYi.6$qe) '\Eqjd0Vp; -{,JY%lT, Bz\Ow!5T$qP'`^p_s6>j'1SB=Bi('+1P<1YRmI;̡f2d[:^A{rd""zޗ*k ^l2! bX:+ @ LV}$ֵ>zy80qH\îN_8¤!)RF4y|x)̛ ֧B'WG@ʝ ´ &l"<- خQ}̶4, eIwoA=Xd+m>RuBqmf;4I$ H)?DqɄfi![&࿻[+)a#c-;[+$mw$"BڗL2ͩb$&tuX~eWoh`ΕAs) 5zPl z˪,{&Edsj::Q+'w6yy<{V]mBir87\28+qގ0dJ5>`_{Oz6[KXn${+gI~NfEWA:Ⱥq@N |r]vVL V%5WkPhۈ $'%Rr 쫰3- B;(p; >"(}20R5f໥}N+*Z;Ѵ-ЁqTLR5gnf'|Ů7 6kYY}IExC-UVJao\)*[)G /K(aN^&fTKuw]`,T㚼 is}&}!{cnklvSZ|6$;!۸kzy0v4U VGf^ߩ2mynI7sU_̕[Pi`Lf~.! ZVJ !#_]v'sϮ"ekeIV80\HwEagUDuhK('h]@ SOI]X4MoD#-'M2$43D(5Qli|^lKU<|BRU~Qthp y :}$`B^|5ٜնsqfx6JMsQ jt>~73u0kR ([uzn.lڌL~ZyIC".7̄| ڧvi^8 պ%!4@DÃ\)j2pf=9gK,7. 0c[@ll$TǟvAYb0$"G1" YGB:;s/ ="a."+D Ju(*4ԂaB071[#VmYLֱd> 1[naicBEæb;ZE9"tuƩVwm`TqO .!m[$aJA/7wYfn=jS;vm 3c czЩX F1#^DoRO?$촹7mp[IY lcqLj-;0^_߻ msbן%[ n.cd7HcHUդwPRQNrܻVVa#d[ᕕGAvV%<Xl#y#B#(WX %mꡫAf6<@|D#XdpDsIm4 Q͒Y1<+_*INrWűoյp?cO!++#b4Dهw<| -Mf Td ̇bEcɮS$B7-Jpzyރ' [|L6vi+f6+ Yb,I*s}}Jy{|o[<6fanI$y R#xW~JW䴯jsZeD={RYudW\aa-Uh{' &p^\QuRFSnx`*eɴlWeؑkj_}h9sťK&2,m]u,}" ^MsvZov^‹hvKHaZ2TOkuQ%㍱bvua^dcDɤ( D4 ;Y2)9cFGvu~bv*;B*쮒g@d{xg + (2!ݓ3{gǾ<78a'1H`XZ&WCR1A U5$q/Gl῰퍫TC1OPdI;qimaՙ+`ՙW%&܍Ӳj-1x~a2k3+Nj B0\ƽ)f٦O*g(qdN#F|eCGj½TEN.ry3yC.EgT$f=CjBB.$%"\H<.;#ui% ݛ]& @ֲHKqn+uW-q̨ܻfrFñd0׮g^ 's.6ޤu+ 1a_giSJ 96b«' UxV6qұ?qso xm{K,7O5H,-HAƴ$ҼUo@Eon9ٷ&\cg,5^h7r1d+#X#DDbٯ/̃6n=\'Z bO[aq&iEM^i^b{t0!n'FՂA˲U2Cc?BC!! V/>_x{!VQ ~vnTy$ҏ4 -9# kj\^]4K{&qR!D{]:ՉԖ#_PxgEE,@DŽv91JPd89{|I,}3*njUP;?Wi rݏFԬ9_Ⱦ]_wc̾Kߙ̧2s5MX̞#`Ji H>%N;Z࿋뭃q3vޟ?q+lݿlsl,.I(. As)Jh},1(!8nz/& 1j+`2׎-|g\;T%{ W#XGb6Go7fc PI,&VРrI4~e@#:"O_An-Ln'!qoso{h(3 ܞqwtbchaHkX Wflhdeg`%[kiB<ݕwB-2wq22)ɇAupwSw~R{ v6Kۖ-|4b1lz,.εc-+E:t(IîilseUy8Zi4,Ŋ+OWUK8%W+y{70:ˋZ95ک#y9ܝzFd`N%ݞ [; m(YXUQldXc#E -vկk]͊Yn,ɶB;QQ:::<yK4QL]]벜\w#ntV$rVWQQX/s:=Imgi\%Q}} X!Z})a<[B.e.AKe{p ]FUCŅFq2/"\!ɱ'5OȞ&.[C5 sDdw{DDXG1Ң5W"y˛ky}֑_mbiK\@_ʲ0.ѧU(qm}i[1u7YvvIč8CI1:(Lwi6QͶ51̮*c޻s5F3I|gĥx1dHs\E` 9♍yؒ"7@N`uYi F*C^DDBDV;O'v A{3/Pk_UqɅj:A:[+]яM7k#]2݌,VKF{s"J}Ō?t·ixQغWjd;jkgL$c5icHDVsޤoKDRsW'SUQW??À\hjk+M =>cF 8g|ʆO9bFr/sG *U:*_K^c׎pw?4mc:Ѥr5"*l]AK.حf 'ή$ 8nȮyA=Hrsk&wYK~pZ$vHv 9->؛qyq.p.#,K[DeU$UBɲ5ֶ*џXJ9ip }kw4_d=z#{wipWh~F{FwnƲ:{yPY8}-5m+l@lZ^WL +JѢ2%<# :iw ݺ7t>MC݄cFzK"ɌG6'c7$` qOGɏTiwVޛ MᶥQz7Ij+X7efr6v™cBd,O4ea\E=#܎}d}n6k,x(2+Af:,*E/ę$ )&O)'y4+z7kxr' ,IҴ?o "p`ckf]|Hd+.;DODN`ުWkTgOrS9*6o^&(4DCEy8npOU՛G"4k9phFpDT+h¦x*tטy~<\)*p5gڜ8mUA-+*2mfK[ruY֨g_ֲNF&rw?.1f"_2LY/!`EUCa^C;*")ΦRb-rC/&#iWԚ\5W(R@~vخI $M\|-$t ,~,PQ˹*V 9T疑Fk3r^Y3q̚i)癮V8H*5r'dž :[Rt&P><$p;q_˧qφd6ٽs+6"KHQb1K˕WkR Ңx kr$϶3NO?Ŷ*.,f RTi`KA@ Gg0B9G4:0<8tڅi3jEұ֮5ե5l 472<?҈|N7Uxl F^+YV׋F+Ҭ2Ys"G%dvQ"$ppi^"vV|cLXIO呛2 K.{n )%ŠF?X?q>Ar9t7p#ϲiQvRl l5^%F3F]-jJ&qЊr{1OqylYi ÁY$!_,wӑ\"^Xk9 {p3?FZP԰ؖ B'/caGjW=w^QBdIouE@5SF8VQu.p?CQ fO>Nv3(re<U $m1#eбo &ZSX5.r+2(aA9ήms:yʻ_˜I8}O&gAko_Ӆ4WDbWƴKnEX$h9]Ո {uK@iz6~& m zI4̅ 9pt7B4cBWdUb^נ ĕ&9㌜z{W'<|B|ɏGmk}mzoRMF'XjhD_@R ovBHu ZhMyH/~iq-ód^ OR1ׅ.Y[E( ÚOQ{GZ]3p{Yf$|h\|[$:ܐq*54Q_śS5j6gູ6`hf;NNL:^ٹx[%oОën3 $MLFMTˁ[Svbpo«Ɩ}+^XNٲIqzDZwv7o= (GoeͯX9ekP$$ \d1tHPr<[%6?b/ uep n-4&cܛ m-Dam WiLf-RwOX: hce1qvffD㽮;]wؽ9VOQC/jWcU׌"&l v=h%YͣY&>X= `6.Rl@׹U܆U<40͖q=҉9Uouϐv{ym֘-|+6kopTAcBʷ&?%x\_g] ė-bX.$i CHaRSҮV\?,uF7(1j{8u>KAS uac5 6V#9 VzC$9櫽HS,fHL[Ie8d06&g5n,=Fo,%[%*FqjDK*Jt dz__nmsT`n~.3lAg.gr.3s$..o/G.kއcV3KunLz+<ly{<2[>,e#z55^"8{%޸Tz[)&reQQ95n'?ҔQ֑xx]$9 7TYndi<}ytT_L;'~o_S-SEz]EX!| ;rE EWjF?]ec*L`ϻh eC2 cV _h0IZc:,6%J`J4hVP?x6MbTd%-)3" e [` kbxG1ZkӐscqsHci1L94'zA5m l[m-픱!#h/i<%7E7x$D>8_c9!vUH{\c Ŧ,F7OSi{C4l\{0l\EIL1! 7F; $d ˘,+X{$т:j#ULwU2B_`Z6{^No( ]ϙuiVlXCAO,.o7ϳvkcNFMYO,7&H;X5~4q #"5͍͇SU9mu~DHY/+C՞=\#m"'cC}G Ԙ[eQR[Q lxo-d&s=w ȋ/[1ki#1Z%*{{2QV OMMoH/1Kuf+dn.#oc12BsKKw͎vajlSg?2ZINja|0XFX$X<]B)ᩢwWwUYڟvš.f6u&ҶLc]&[+*"Ɯׁ8Sƨc؍&/W.55VC #TVt+$1=񹨊W+RywY7բ(2j&Zo1A4hBG"I3_Cvm-GqGkq^ȍ4w,pZd KBۢ(X0nRK܆KZ+1xFEu%N) NQzNKo1{) -[;F~#aT鉮xT>|K lr-A7$@b3Q _,#zn!^흳ygiX u==YW,tmG}vIwc y|G15yT ufbm%7䪡=8ǎ6ػv嶔$ Ou DKa-w4 #i{kFwܶW,cd֕i gnq:Ѥx\Բ`Ϗ.|+H7J#L96L }cKmfOU ]C-2{VŐrZ*lҢI @EReSꆑU!酺]c܏߱FI#`DI+9TKdIUDLMr6n;eO폷m(8j0x}Sܔ-MRʫ<!o  Kkڊ/FiM"r2|d]O1XEfRiY\N^ !L$~Vr(]Zu0 (8ו A}-*[lyEց,jjD#PHfh6l΋XB4Ċ&/$[&ݼ2Se${V#;^6,3 ϲo>K ,,S}B,8 (I-QJH!5^\[oue\Ar`̲)̚T",$@/q{={ũߧ@H+(Ǣ,׌:D?n~X%};gyo?MSbڋ -˺w 쭍7| F%)KSGGM:68ejw;XD'Ԏw Dthq4Y#|9"0VEy_o{(oow3(M:'Rvd.+j 8;[+w=b'k;ukD3ثkYnV7ڳG/a3hlc`vVè%TuƩۚVY C0'R7k4]LC!D qFXG DsDڔ8 ԮdȖbdI-'A&q%e#J(i4#[m'wbƺ|n$v+ܳeJRHpxs򛯵F 2iGɧbsNLVJxcEVUEJ9B3Q9^뫣;W_+Y0e# ƕQ"xbnHf5aBX#M% 'uڔ5Y5 {{Lܩey+o{s+7neyn: yy/rp]ߴe[|,俷YQJ裙O?-ݶf3-70#}l[1&U]KSJ2, ?q`03!AhL: z1FM0!{ܼs["g\!-Vd'@pI2r"(bπ>7g2B[ N٘&B||Y[ApE-o׎oI s^VlW33KmŘXie3 C+`Wˍ #d+^>Y&/bP]m}if] 65Z #1a9A(T,s쌄thEP̲JQؑ("`XQXW߾+=?{v2&^LEb;hJLe?pQo_xZ{՝묿d2>X{R`lYUMiAqo%\!ZI4=;_ jiyIJޒMgYߒej2a @-bpxwv>^um,^&,%F,R{m kM_>-3x˛͇ece㙭ɢM fwSp5b)/Dzb3,/i:YVñdul tm~J*?M]E䄐K#dFThuϜpw|{TxiO? #1|cf[=v4!蠳]'7|bˊfݙm v6e]"+q{Ak%I4s~L il,:Tg 3thw< Gֈ[ڟI/7Da e;^!ئFPckQ<]H9u` W>|z_f0Qfۻ hgid{l[<fi{#6Ƴ`llѦk8Y.:#JcڊƝN{ftRף^mșXFmM1 y2›_*c"?{Zc]>;qyݱw9I!Uw Q˩*xh֮⢮|f>7YkR+D\YKDB @j _f!}}; =)p<VnM;z+ܾ& rD$Mz/D-' o^J$Zks}FlG1]3{#1ۓk)䮫$anqG5Zqm9K+E}$a*E5h ɩd/i/egB^a~unO?r[ >rQGY5}Qs|͡D}ܛ,OѫP 6 cRY)/ 0~Offf͞ANuGѨBԡr9::I> pf>_Ewykˋbq$q\ެQeZ]ےȑWX`)\ZŃy(YDhnDHyU=TmsBQi9bZֱ:4TUF`UU\?_8p.}?/O^>rkRƈCLG$A(AC&nV+kǟpWvPi*at{;) :RisӗFWv8M9)y$q}kʴP*K@^ ,+,v:˔A1- M#H#AcEheð_"3O=WɻW_&dGuLʙ!E7kYtynֲrwcՒ$V^MaI!fJu,,_q0Sog{ h@ݗ.4Ƶ*qUY!Z 8leqx,~r $ ȶ4%n]Eva9c{nƲ-kr,ojhbUF̭i3j~mW+Y |.z(gk))U^Z![G$[dgV5D:,pJaq(#/_PNar9/fIcm,( s !5$GX\e+OCs~=G y&a(XOmZov[ok݅{JѾuF޷U76VE6D 3+okj+[Cb4ygiLnLr5^S/b-e#QQ@4\ϴij=xI4w/' [MW miR$Rb-GSet[KcjV22 tq:8إ"X})R/c#Hlѱܻ∅4ݻ@uPuQhyie@G/^e[AҼ|yTf+vdҶh1*iוǹ1HQ-x/6Y*?U39aXDHň®/^N/'#]Wd3gʮ1:2Q4rޖL-D#*_M:>"'Y^U4zzδ۹yT8Ye@z.2/iWa&OyB_[m茆 't:hFl*xQꙫbPz@"{D?F'p׹NˏlgIFQjO :WOV*&#Ʈ}EyP=i`=/*]B~^i9ɵjL#j*#TFHcU#.{YN icY]}䎾]<)UhTbzKė<*Iꊿ|V+|akoid-24 .T4,2Yy% /u QSȁa»o뫳~DZ5Rr s[dIX~y[٧fPVsd`~Jiq:=Y ,b+Z֧Qql 8$mSڕVAO_vn̮ew>7v^Ï"XH!hYR6gM4%ivg9;ܓ;3_K]Wcus,E7Ү '="REP5ʁs=q{t`ڍŦɵnb,mf_[ɾ$Kuz@qUDW=;wόkp&+"UpM>`4G,9G8dy&P AcG?K^{3R_\^9&;%tyȬM"DZVǿTl·sUb}í۸{2<ڷ,_K-ʡA5N=w͂jKiv115uV¦ɶQ$t .觙%,ow'=-kWb8`3]۵ԖQJ; 4[T]tBH\qO%iLh ŁVYc2,^<<w8k1$^|1|X/wih;U PMzEx['ג\߰pno@Nj1KƮe+ii#ޮ/uVEhYٚG^mrNn6;yOcΰɅcp,)kF^r};aXa0⵳ID\$@3pfKh䬷$VnlsYw.4-ՏIWS&MWsIc9lYAjgdI}lPB&zMޯ]X9n1ܽ-Fʰ°1iS {;-,`L#:X܊M捞-g,T=.V<]BHE JqmyVNq!Y[l^Kuya䓮DXbxFmN':r hX5U{1&'nrso"=|;*eIjIU%͗HR6^(SG<*1 '+:U\|J;fKVVv Q8GaU`t:~_N1aZ,[ K% jZ2ЯmvAa^{[?c_K:գ}$F4X1̎ #Fm+\/~3v MU`g m˪;'ȈC@B T8!=UU<%>y-`cYaPA퓩WcΜ^Qț=ӹ7@k[L(1@µf{T[#Wlgfy_vWosR`JoQY;%]ZewıQ Q_ɫo:G:Vsj={6API>5\MI hvtBUpnOܿvY@&4]!@ Ebڈ4^(}Hy3ȟV;'csDe7:G<ږ57 7;ջ]vyۖOwk]E7$܉I/ӮZ.A`ÁDִZ()ꪋmIAM]:MߪhpRزdvt#EƢuW]{ll˹iN=$gz:Q 4P~p{ovpd&clL\O4+VWNMA#, ,ƟÕjDiP_qwxK gU%SyAF-~'rJKx8uCFUpNsڶtM/,d-d Lf6wdyxtl7~E.b$m`T<؆ [WH#{ɛbYvnlxx\I"dT oZj4_!';f+gkæخ HX1}`W"ll~f 﫻CG^[Y٥hs,ږetFTʛ?P53F7KY3G׫Z:Y݇;Zolh7 iզh$ Ǭ_M/)t])E' /Ő +O9Z?۱Bi"XM:0h7պfx+x,Vl'pKߚf!mwԚ-m7+ H H Zں*u[#]gY7uzK=I,$wDȾ_ɽ>b [bM{K)rf^1i=҂5&AG;h]6Ή˝(uV5Rȗ&-AƝAHZ IoHI,`XȻ\H·N&)jC hN԰vcz$+^ݘg9ZWr,?^.pW[91"69.k 9VJ GnCy"Y_sWk${v]᳗6˶iVx{Ѥ1]+݉Kٟt8e=h$6V޽o=Jʐ2.H䋃[jZgil|e`5~srn#kQf H254!E('L[5N>>%~6> q U}!c1RJѩŠ} 8nO%9 Y㓼ao O4Ŗtv9DܧD3~o2=E_/sb˦+ iln+_0vX pUB2+W]wݑmeT`MSvfUUY@l5Ѫ).ȍ=tboYM218k{sԭ@]mtb́}[7^Fq}wN赴M}%֙ j~[,H |+[b{-umob&ٷY2=+)hV:6 N:Nύv$wbP:rk4#Ž-v1]:m9ݝm$Z|9g%a{gh%7#%IR) t @( qטaQV[2=e{gqVHn]RBӻ=ƍ>{ fѾ˳n,ӵ]3lO fĭ_giǑʑ.Ep"Q5n8۫ XD1{j9 EW#Kc,ȱh8ODz*x^gYK\}尴h: t.IQ\~_žVvۃsXF5Ǫ=R);kCl.Ȼmܴ 6&Kd I4Td sZ)5-z9- [L*I]6UD$SwJ"J'jgڙڙH`&wmp&ԥGLYP*QъJP4quiP/ *WX{T`OaC1?On夶VrJ)$$T S"1Km\[ZYahv5=XCMk%&1lt9&70ɭriN||y&I_>1;ys:XqX dqY oXY;p~"-&yv֬j4"lml3\,4YRjA#LOF!y(RMjC`j=>m{یm}x[T<|Ԛʮvl˗MRaq0:Yhg=c*=`._wGVX$rS) 5{(oBڄjҨO:$xhX.wG$vO0=˃T\U7, 7ke R^ $QI[H@Ёùv\cai.u?LmTDZ,%гG,ǿU#:g-NW5lFƍ855tz9'J&dmNI:hJ 9gҼl5Ps~yC0ڽnjgeW&oL>)_WK dKLmaᘄ, - D05vsH?_Օ(1惈PdId|t^s!9HGtx0tQUd!ISս*!E sחWBZWc9?noec8 ﳙ. hꫠ lQs1S4ꋙ4lDsҥ-{^oZG>cDDTU.G^;+9%E6? rz9ÐKYmP Gm1-Ɏ[k* j%U ךXQѬrc\T{_&d+:ZKP:5|9QI^UG'ȎD""x;o\,22r=l׶Ov'eMu (Թ[JY@@qۃ@q$MP+/llUHU{Т# 4W|ys[2@(E}Q <7KPzrė2mI"(4dțGfDg\9Xӈ1Ds9O eFRy1b+9}O1{؜"u/M[a @א k~:mQ%cHԂGJҁO% rdYp*aA-;hHtD(ݓzr '_(4xbAliV+9xV<ֽGDO>ʧ)Ǎw-'7݅"K)+૩%H #\w!Cj(?_8Mm/˓QkN{H"H䫓^r<' :G9XyU_ 6,guLD$5hSOc£zyDbnFllm  WzFTVc7:o \,k ʍH+#0:N0X[mٕvU+r&E4mnyFyDŽG|?N;m B'`y rOV$-Щ9Z9|Fg9/QeYMIVeOt0A29RCOuiH{Szbx[Ww8A6V9kc ir=u8>˛uA3 >3cay4{{tեMٻ6\v9+hrb3%«:}iG)h[-J܈^~%[m <;8{e!hw pdSȱ5DKXR:$WrTe.oli3+U-*7".Gcw!xp|?_mXnd`m<NXG%ߐjvE ><}zd;6KX7طkދgfuhYE'k%8M ?4?4~ܞ47VW]Wa[6k'!-7Q&V8aX>1"12|ot-6YeYC,a\d9O0H]!оՎ×/$wd&6rI,Ȳݑ",cSRջmr?M$kȖ EZZcSr"I>BEW *wtnGps @v1s1cd8<9-@g'O^F]c݈+1*DpkƑ(bц#zNȬ`#G~<Bcȕ6FU`qr( hjՔd'IyRK? l w_?i͑k+$6֣qozѢIdVh&D&Zȯ˗;I9vTTyiY Ae2"ar:̟}'c2qbh7q²wY,sH YeocB iaUF1#Esg&rt @%uWQD?/JNU2z.{/kb,[Ed cu)) ufE+4qFk/Rdg:t}(,xXUYecrI6j[Vq F41lWFjXX(hnF,o+#Tİ M</EX0ڻlb0m2s'btwG$31cGM$ȇX#ӄO'sN۸=ŏڹk[ۛ%A=ZTWGa[{R(Ė{]n-GGYߦG'{[̙w7^kf=LSoǙ DdQ&F9Z>$i#I8mPUtȬ@e OQO\|F|'3{pY0Z4krT[ܣ/$ADO&$R9/fZ%ܐ^C:<'puy~O&z74aWƶ~'mKrFʘZMgi"D4qBL?L(M띫{fٻKX^ef.#[M_^;X-,rJw!J}gcOqvCgnEh4c}ػMh\*E'wYbWF>KWkfl~v'CS:>YpImA!tJ3j9e嶩:̦0 1zQWO> nԟ<;x2vEpޖvݻ{EꐩJ|5vCj Q/w[gVk˛M󈼎 ,ĥ#Qf -GH >֓{ܶ- ~St}TZN50:ij_]VKϺW3k{۶aNX]^Xex޾l~J5)ŗ^BK&X#yYnכ2dL:[-tG o*L!{yP˖&h ¾|k;So|Qy'uo26"'semr~ 8g#;l_cvf=َ}U ?,8P2nWs6GpYaE`F_N9Z=o{#D@oyFEoܱʊ7o1b7oQ$Co"G.+5{-AFo1,2鵱^,~skmzRu+[MhƍkQoz1wgm$I` n3*#V93@>NqXq<5ĥt-7s_]]M}xtA4}Z2 'a*KwcD/oh >vϵ%ôwptv?I<3kieF6CXG>TdCwl70.k,6u4.m%4Ǚ bάO =F/!W qeqOK/hՓ$33+2;l׀yq۱YZ0-kqđiVI WU+;WeCAu??nSZfVllG}<7Ƥlif=M ~C;n,li:GH.q|E5XL u1b]9^TټFo/.f,՜5lZc"LuwR[b25[B'jx%aǝ6'J7W %;pΨBX'j}O_˰,J܆꾍$ kl*dX`ƧH$ 4/FXFv -2Yuּ|qB+ȎF8DDqx^UW ;pmEe)degY}AT7 'C-of;+x]bv~qU-i!]A-QU2o{:$Bv.OM$$3v+N{q*(s,v0p9tT-5F'}~IHͬ[Hk RS#$k- 6)K*U  $St`8vjR6ek6֪@է/?< aW[?v e`[e|~,N^5ٕ/[_wq{{M~ AFQygqLr鹷)$+,#TZH$=@0<}M2x;~w6°[uٹ/a b:0HH6?ch-"LolPvߏ=Wf[eMm]jb04gFD hH$czUVɾ3_B:QZ:$ V'םS<' [~d{C.V;\IMW!6vMO;N:k0k:; 2mu]?*=gK9l5o8y~ֳyi^ʮQ؋ZC^Z\|_}:02Ce1Gw66ߺKog#k;Q8FH6]D$rG"c2hβci95}V u{ibDzTFҍ2YO}E1"޿ .09cn n&H+%-qԙ1,${=5>G`\&V1J̒d`^zDۊ4Pxn'.Wvu eYd 鶺w^UrZ #zfsc5q}almQmRrg=Zl Q+7Dhޥc;oDY3$.DZյf(HԖ#зӿݗ76p"g)R6 ]ǎ 6]#Zʰx4v;2;!zۿw,2 5}>D )"uq>,Z޵NAX(3C)gT{9-%EQ38"ʌتtc#]yLdCܲoeo4tFMQ VUHKySGV>^cvib -muom%̣{:3"v{aMvl\ 8+R-fT;Gp\N~zDHġtݶ'aYeӽE%uI+Г zFut*=xTn w`e"_v.PhjhY4D_c}Apmrf Ţ]K Gq-cc9 dKZJvor_گ>yl'^cŔrYa*91t-2:+5b0. Yeֵ:Ϣ5dҠ}Pu3bϔIST圸>;|ݭovVtν\N dB 8u|e^Z-%I(Z8{ l"@`1F%OUbN]ޏC s-WT+.,Ecx9va$CS^/K1FqoaOΕnX{"N|`؎P '#ʨ<Ko[-@Hu>`LUY(DI'JxlGqf3VٖW1X.m2<qk6]'Eem?2ڶ֮de.l3)6O슺R=o?`R+Q/u*f7y ܇Ҳa:4gϕ2*1Ó6=Q>C#cguq\mnf<<4ev#+ \ztpSmld[UbuKFken6Faώa;t?g;3]Ugw,lf[6WE=o]\ :ul&嘜vj[Ljbf[D.D2D㱈j";-{ibswv@>z9ҤZ6MI5qKY6՜ֱ33wj,ķdfRO<^]ik|E-̇P#[dxYND(VGCZkPOmcٵ^$"z%z#XzԈ*hFk\0ׅg/Smyb8(h% _eƒc,@pYf7i6וfX k(+hL_:05e=8dUT2CP]Rx6vwv=57Ql|CPXfYm/5å=&?89ϔAE cWraDKseiLѣjeRu (Ҡ[{:Lb ɳgԎ@zs-෹xUyE䲈d(LetGΌTǐY^ˤJW^CĞߖ71,f(Nufwm<9Y.}=ג16;Cx!}KttlXh tKʇodK*#Å {kUUV-2BOpe{+vURHci 8U[k+\&6'aسi9(>s~*zC]w/Swa˝ٱm1+} .|nKLHeW*fV:>h*"5S~&c_NG),a͝~AdC].R/ ,0j"XaՎ5"ev# ,4քSg@s|xfI;g!>Kx^GSI~VN9[°vU$#z ?WE7FD @!#jP筇j ޷rz:~+Ediʿ/ƀzr`A('h P)dc9)}6HWH^5$@`bXd5K!YGQ:DRh㕵8CLlu$|Or$|9t5׀Tvy̡'gWl!֗Yu=خCOlpFHT:!STK{b=1:P|y|(+? LD <cƿln %hCw@HI͋b%xذMg1/j{/ Drn$>)FU`c\¯ Z ʯew-8$I+iի}wƔ3]c^)2T1jN8rKη!e^hKL%k,xϘD|A,vlcGXyEQ "UR9"9D99gʒw Sy pyo'dY +Nxx-.n|w^VżmՄdWW]eT!=(bY{#s}Gt])}zI.sdz/t){ Fz5 XNrZl.˅(+GO n mJC7J ч0kqKVـs+=U Xlj&<8\6 bAEiZSS>8nNvIA 9jZY`!JXA*|񗙅UIܮw]+_ax\<ϭ*\DZaEIcho$,d{'&~]hfeqAh, xV5:+H( o{Z3-$(IW"X>ځZlO^-;?%}7K26q0_^O6e!9\)# C->;;gԱaT \ũ("/g-jԈӉx]*Pck]:ťpUEC$2=^9KЫ0vūlB$ }#O⟷.1u bVfZva:3MiaY>Hƶ5h2,#'8T9@ x:],Cyi{i^%<XYV+m]/$辴ewO̜xs_;1؋[HZ뜁aika=*$3YX|?vݻVec!vq<iv &(bEb~{=L/ug7ȩךږayz(뼬 uP'GWaHηl}v<ϵ S8$qdǂȇ$7bF .:܍ .3oѤXZ)4Nxu0bs5#oqUs~69+16[w MPo瑣e!.#o7+~xs]ݿSUUQi$};V]Y;5=M>c2)[ϼouV-e2یY])m #}ѱ (cC!L;~FzN{˳r0{c4&2xic0צHGqVJXVr?sYr*H.BC0j{anFg⻸/l=\x4v-hu=wAu5~7~- k:kyr\ZuGf8-4(G ZWtWzζL"/#V:qb$wkԲ$/.NMhwig^"Ds}*Ə/`bU:ӊ{b羙m?xZ!hm%XZ9bI0* \X墄u+wtw3cmM% ovg:d\g9G_Hyv9+T#S" Z=waj--mHNfCj%_CV(E»~Uwf?p d#8ib@'J'SPo}q߾Yؒ[d6йo xXsG3w.啢 ~X^W_ܧi=$ig٤(iZ5x,rb,GՠB'ER7uWm)9n^;؜(Ӄz[vl;0#%"WJM,ǽМѽ|U!1& "J~]>:qW9{OYj&ūx:~l;Sn*/1|ikiWYRɅ`)2 L A \׽2Gpz`ϻc}YHz!2+𫝧6ʡ1[y15DjОGP)W{G6a7D7o=XO-W78m|3K ̒DrKb,JXs؏t'y1͝Ljl!ǽH-=dh櫵A<ٖ$Ǝ;^ɱ};v&z%mbqb9.%` %UŘ 9K#J(fUF/[?mm~>)qeDKh` H2ݥEiy"fh%d/#ڸ=LT½Ƽ l%0eyvH_#fVGOsyc}i=v2`t]Q&%ܹ%XiO-q0VGb&!r" ke;gH2'-owIr 0dL! 9cԶ[ǐ (6#Q*,UjʫBrm^(U΢||OV=m;{K{i!fhMHеI*#QX"uS-YqwX!h86UnDsͥ^oRgݷ]էwf>պN9>?<˱-ˀ4-2eDikLJ7;>1|X'%-hf أ UW{+_=f -%TiS#I)Vը0x?ʾGYyk7kb#Z-G^j (Q p*\_sߏ=÷nZ*6ܽd+=ye0Kge9҉_\'(@5l`iSeȲìcΠ0}iZE+<$b3^4]\[ .6\c^@fXRZ3%Nj|wpyx2n K{;d)mYd[P- P5Xx⃰-ZkCc~2tZS`q5&/`YT8pfS͚;ACRS4Uj/zn&M;ZAhx-]g \HB?~>Gyqw" 9zJfɍAq/w ëZĿGA.%!Tnp b]=GGI8wU? $ye5bͭ-;qS1r-]eLJҫ9&PU^L$篤yeL?|"X,XfeBO+"ʱ\p14r$nzqNv,+,nFOeP)3oi{.TJtdžtX @.16dۚ"b9}%{`21 9=&kUGwal޲fGq$Q̉#,JM&È?<ٔ}orN\=@X\3Ij Xmda;$(#hoS/k=vi]UL}k2;9y>_m8lbldAzmE:=No4iŊDF!A+lȦY@4yҒLuhr+R2ac.J\L]'DFR<3?K>Lx2O#cV[%Vw[؋,俼RΝh4."{GV-wu3mJBews=`FUcϧr/(۶l5ⱋcuq\'q[2VYŎTR *$|'>sn{}pm.R!7` t]_w?&:_MA=rkdn2[[A >ݰ$Cil1N?8qMjn nq(3X5&2+噀J(2$VK>4^W507|6?ʗT\kۨ{'+{Ƭw˫+ eUr,T@c1xs_B5[9//uˑp^eA%Ui3 D9eaHrGjŮiu da trT'KY&AՐ)S鉥/(*y' -5=?+`9f~ tEɐ.ZG5~T(H׬Cϓz*Ψ^Sқr2AUJB# _ʢ|xW8iTPkȊs- @ *@5 J C{gYn"QEd9D{N1Fj׷ގ ؎sĎbZ]D]c$dk n&D8@j!dI5,1Ƽ,_fly%;*NҴTUTn@ce%8 t-ghjV`M://o^?4}p7cUu4ak۳">qq9&RBO\įHVt8r=65TkqޖZ>\,e؃J(X5{Fǔ|ّZ !qTHYG^I{m\|;/-LjgeEz,q'X$`F<,-s7ֶ켌-dCtITZD´`[+ K#={#}oܷsǸ3S[kXsN[l֕ŧ;%`68}-.}PK\ L7ij38Nn|.G_ NXGme^4оC?dY|.zK,o=[ېDVQZV?NYO%x{WsKk1׉5b9t[ݟZ1Pimf[ Y}`0á$ 0{:΢I#U0#eX! .1*Olt:4hE*ԚB9x PH~}kqƏe}~O+cVtCĨ,CI&/noɰee(Q ڊ 0mx `kIkLȎ/1nXǹG+z~b9xF1jrW9yGB(P UV&U_]6VofU9EŮvΓWbzK"k&rƊ(CXkkT ֒I9x'['ꐈ8k8j'.UKC #ԏJ}ާԏ^}Ȃ{GۗQe7q 9Ia'%qaXXа Bȭ )^Q8h$FQj17V V9\WL!e8#@j=M=_y LP4(yט3s| #I.8kÅdv"d(wIKմ288QFw+Fᬪ_?G(5X&!;XCc#ϔ[=-=B0\!nEG?\*;yLn }qcUI$͹HWc;0YERv%Ƞ1H" ՎBJDGXڸ&1*^#^2_(!r竸s'^4 fG2HŷI%^GOAԑww-nn"R7 $vQ[el"9 䁮@ #Z dHK| Vc֟*Giȡ`VEݔ z6i_d9210.pLI5b*5A9NQ.U ֹiMHt I,Dg.+ n2-V<5j zz ӟOe3hzhnƟ&s|#R|_$]fgg&D6H(j򚍃^{zac+S+y\zݸ2kRܡz@acܒ( Q#o x|\S$:vA Zi5i,ⷓL!^֪mӅcaIalqn3kxM/1lKMCOqHb`=H"Mc:P&gts/FDS^G*j{uYHkh?QzqݬD[g1,͉bL֞l]]6;ѥGk _3pcqg}bX6I!X't"5z]ʧr_26Q%cp76ѱUYI!SRRIqY{bE Z*WJVEhyqh~G6g6aP#l!]d6֯ˠʋ&dضJY5;Z5V9G5m{axmE6VcKxCOMB:ē*iÊEUsy_?Mbn鳻{G)Q\Wy+0B,H`8Rܻl,$E$QЪTs*VEI4 6kdͶS7n$Vlq] E,Zհޏ@ X Jjd}$<–i_X>!#zDsyB*n6(~ڻf廇 ]$Fcbb PGG̾=y+`o.f YK$TYc[ c-qP$p6o_Jtڸ_UwaDz18T1 hxF]Obyrӝ¿!ۗlJ쩹uu>ћfTG &m&5Nϳh IesdCUwsHTX+x;[Mg!59T( [s wE1M9m=pLF'4ZYYFwm܏/yeR;ȧrX?RwȶWKCe[f g"<8D^ŌWc$aD)4v=>;)tYJvFWUNe\3n?`6GhΖE"/?b_Ny\ۊ Q4A ޓX"= RhU,gkᙷⱗrfKx~R8,;LB${V,OoN?0y;չ5_m|^5CWƊlQ"z[9eVic5]lyU9FPE1Q|-&Xw?ͭWdxcpB HNLBym}k}9yēl܇d#LǏW@#vYeW{maJ\?!\xr^E[3%[k#6^n,]mO6M#XFNlLlV RC!Jw uO21>Ww[tk90k8V9_YM\91FkNO?o97[YGq+ 4[?龍2f ?RX~M({н_e;LgWcGF#$WF@SϚ &:V19Ufӛ=&bp"S:y*u9Xj)~Ms]:D87x`r sǮ'a3=*Sʄ 4*Qט>|v?žE=Ǚ'in\GsbѺpk2R1mFѳy[1ֻ8ָgm%=֎ž h^ T{>}QETX%dl [UUp:**^v^͐F$H*=ӚҠa:}AX>7O]㝅qn3-/~c lImI!$Tp,6&G Iv6cCPwll{{d2׳ x7e"2P>ڨB׷\'c8~9[W(XBC ց F^,HQ;~EE|+7ۚ|ěōoF- PzK*@^s}=[/0ۂ/m-35OsMwrmmtRpn[A ۑ4]zsjn#.KbB{<⤻I "'*jWr+J1e16@ٹm.E4fEU{c﹯d_ml劅(xnbmq\(T(a^uHؿg]-~)ܶPK,4 |Jqj,NT-f^/C:/YiL*k-qSAy_Yg}U'2WEm b c=UfUCaCT$EiPdsDy_E\\޾WwH-Iv%s @@nzYR~|1-Kܗ7+Cioge3a%'pG& ye#~8Ʒd϶ rlNvD*Ge|8V!1Ԏsh>G]W218';YpMOƋ $RQlQ78*1@F#ЋGe#&Vg'@eU^7vIJ0m>k,q%vFR.2cݢ4nr/_n3Ag=ٳ+sweuimS-eH~f!h1KYR]IN5mg.W7np4̷mS;5&3LqhiDzZ 6{FW\hI xk# J/oLVۆ,BnQ @ $M+MeI=KJGm.;}Ǹ8K/ fKUbF&&;osn{&?%_{7'vOr-Y*$WՖ`FBBH&GM0W9 W6Ɲ7t6>bɭ~@qyp^6S̊FvW r5<a[Qq2fKc40Bt}l|!6X뤶?+^x\3̾Wx>O%co}HK[69%ڋOtCD~ߢu|-Ŧ[Ac%y;[nodm!%Z瀠fhH~H{l.ufQI"W _iZʯv;iyBqF%Z1"h&TtsfTi1%F1#8Gr[,]k(7UPJhĀ@Pt=.!yf^YxVY4N{o1\kn|?n=P9mK/Y`jݻSG]%+B{:5cNb+[4z[GH-ig_)Ĭ `54UrȞo7?!kR7r(@{@P8mjxn&wl͛{5\"Ws=Z (yi*N?%f]cvvyPl!crM$B%faʵ:;Baf!N0 #?Ji>ؤjJyxCPxqfǍ*5UP_^G|u`/ Rc?[AS1_C׋sܸ{ ᶤSz9-M@c!$ Cx3:;Q酖2*L_jv ocyBJTC&*dj1IU#]u8\#HwU\lN"rG5 vWl; aVp9$ Sy+#n+ -.H)k%M*02PX!QLTHlcR|0#ZZ_KPD֊LW2MV> +G e.x,10RƶKXWETkgt_m%"WOhR?E}M8/|v͞ B--o4GSzEgJ{m޽+kYcMʪk ;rIHPbCTΌuy~7)f6(Hגi7?Ad쵆I;ؽv9k ?5άd kLzGsH$#@^We biFݵ3"qFQ4 g䶆) GJgJ}:|F7㏸ٚ?-eH\4DZݏ-M5_tG{B\ t6>,v5r٨(uPql8bURnԙvfV95Ll&с:8pmfgdFZEJ#^oC+~ddX}~ŷdLX7yVpiWJDGggwKTgEAmژ,0;9 #c 9x9 UH(Fpv_`VT6ɝuc}Yc ,ԶፚX[ܼicވg9Wi>FG`UJT~bx1ObA->ʯH4Ń[w9䬛$&tIpxeWc5ȏ E7rٙ:&JJ*\ VFI&7$HB2u !ⵣ ΧMW`љ6DziL,NgjYwai_]Zeڽq[.G.t$,XFtkt {E8l;j%8dlnY\&C++ 6m:)Fr8VO# 'u*@B*PE(x|1@cd/9KâϏ&Q`ʪYJ涞E!Z3bzn{|*=ib%GZF8t6B^ =£_p/bRui骕x,y %EϷȪˌ_;6|J@aqᶂ֐WS7J2/*{~ZXC@͍"J8|VI֮G"xj>5*#@BOO‡ӏ(~n^bnB˱WU7TXEPca l43Zp{8ޢD_,k4 2Jf$Ts"*UW|Y BvtRkִN|qt"4Sx.໳`XEvf%J9r.-daq>5',Ix*[:t1[jڪBD"7DL :FA >mpK|N|&n..nE t*=ڔ"3WqJ̲j$=:rnr#.+k{ SZñ}$S¦=PlWpHL_s+}&4L2݁?;R$c u*x&L:>EKi"'ǎf pd2KBR\%Z,Cwz UPB}uRN{5;ޝ'm]I՘TUљq/b]*^΋FK*!Qk*R,{%bX̩X;.+a9#|w5Uo 4fc5;nmP*J87ȼr  H4 (H$7*pEi$d-:R> @ӯ*qqlzfv߂ey.}aM[.o2i4GAMm{XŦ:M|ؒM Dsk21D $]Qt(X4GNǁɎ.kZSμ Yb,Eí9rĎq;|˵؟΁I]5pͮaͫ jmdZq&" zMAשUEV]K((yd6z*t~S }Exk2yX ~8HdynC?}fnwV!j[E!rQlF+Qy_ya^0&Hyz}G)XzWtMqƙ3J(:5=ݍ]Jys7t7ec]L yBrc?#t}MUD|x [!Zy!8eV0^G;jy\^ES`H5#=MKtx+KI5*G/ ӅQ, m][4Ht LQsmhѴLۑ2qB x6r"1GqDFjUQ~#^=G'B 9A_ucU~`>AU1ZהyhbČab,J7--{Z#y|:A-wQPjD/ug")Hk!V!RZQGk7*'V[/^Bxek &YTԝO-u-r6=8.HVY'eDHժQ;J+iӺzZ66mUCkn4&ȕY8~)K:-kmL6[mYz>Qdӣ=ЌyU<lhIC266>V($x[,22VG)O <[[qE{ $/E]Echv܂~x5̯) [j9);Aы[dUIi1T Xt֗{>7wyF\ڛo [Zp 5|ԲT]/_KHףӔ\n4n8r"<\| sҴQˏu[RCf& $C j~mMRHkp@>mL7_gZ(>Y2•! }#Ex /{ɚ_H}?d02@)KkH4UCWZl!yWrS|טd)tVp9TO2Luǎ7&/~Z*Tu \rqܴâVkMskZV7Cdc)6Kk3My}8) 3$fՑ]`OY!W25$V5U.Ovu{qHݸdUI=֐iXZ 'vі`hnndGш $F m!{JJH˭J[}+i];ZqdLNkc{ &H{I1 }Xv4tQ#rW3.%ExY/G^T7$ NcժpnMfҶX4#I?~l*G_鏵7ݮnۣq6>{i-!y":J\DjgI׋D~$Eg{&Իt]AL_8#nKWZP&/TϨ C!QZw.;^ȱ|w7w-80ԿRKdjjC" j'l{ÕnUVkvsUI1a@b{t(;my>5qɅnbImKiD2'jKϖ^ͺ,`[B&1+JC gJ35_~k,oqfΪf5M_G$'ɥk{-3|529aR]?u>vV5l%c9;q~UG:Ɔ3=3)KVwuctP2z5QE!FENS%v/pKu;\V֖?LB{@ȱ@C ׏$C?OS}\ToYMȽ[5D1q˹q)sw`Gi ʭi $EQ6B٧}dZ˷ߏ mknwM͌a;%aQ-J3Y8r)˴7V.5o5YUb h`9 e +X*a7/JWV6 C,vZN2r @a+ǰNjp+ `~Y,W oIy#4B[:`P{&\I25"~CYU.dUx/)"(1`D_CHu򩵕sI.T[`Wʼn,*Ϩ&1cN*լo>5ٸس[U:^XʹrKDYuG-A8n̓M睽jb3~){ִ#E_}3:&h=[w%uSَ K6{q + K(VTUsFLj:4D^IO;XNNa28ҙL(dOp!b"Eb UEIeۻ#Lxcd:[x=Im\hx~Dܙ|)4)mxWV6tƯ;HWAW/J*{79-iXu6?Y"ĴHr\TJ=&G0^櫺7TUHm;+d%-lbmU#CiJ VG>yO p]tא[A݇ h1(L 7V2w؀.#dv}w7=wwfYPE̲MI+(˷=5M Gӻ.101HCO4r l&߃}x?{|*\0j2wZb&yP[éFun] ~*'g ]!2,'~uw-wmK2y6ywBJ{5ls9kK{nv696 !}41dc2ĥdWUp Q0xlpLmT/$_qu^GP+O%mG.7qF;L+D>NU_#,/4o%מ6vh}&EUie5Y<\eZ*Mpiwri88޴!H$g~҃Zi+b _L %[I#M0=,2' +;+-pCjV@mZeS*Ysj <雝鵇9cBۛDhM--Cu#Ku+? ~a NmlV{^AePcW͡u-1%[C ^׸>CTdvʳ)BSEwcbViBAR$FR1/qv3 wǨZABҼ_?y'ml9[-E%:م?t&6By&4W=vgx53uv4 WRꔦʙm^Q^X1WF60o,QZ\E eX!dGX!M@OfһsjWU8}vNC'&7Pb>G+p \L#7׷FD%=F1M++}HQlIH eJbµ`֠DW5[ω 8\ݖ5_8"+%퇖IhZ5i|q6b-km/=t6Vŝ$hcV ͔#yE~Ȫ{̞ =Ki2̭=zb028(?ڝTjN4{[ շ,ȋɇE o8gGR3zҌӖ;xn-yR<%Km,itkr3Ne9O>eeg+,/-t'Z? rjYL1ȕ*{̝5q@5F(|vSCƎ9"ڨVSO+I²2X7>wnᣭ f AKW5O,6*9I _~Qy𫶏DujE+b-hA=#$gA0HZ6QOAiB}G.:jKG۟iSwGd%%c0Η44m /#KDuqb]O&ctxՆd{՚~ӗd .k Am$-Yy7Gm"+X ES]'j?d.C!}8d=ˠkzŁZ(SfݻC[ct»//682 a^FMl0۸X{6 :Yf?5s\jiYWɭʺm_ nwj 8: #n]ù+ɫl; YZ>К.?b嫙a9QvQ{QhA݋Gn:8լ#!Wb}f!bձdD{Tr&/q[;xLL$mlaJRG( ꭠf_Lɕ(lxJ@% ޸wE"eS HNir{j6s]IgUޮcw`aD 3SInC|+l]TrBx12:\\+:P֑V?GUƑ)[EXs90RyW!֜o4>sX\W V·ĭװlzn3%n%~Áf]#Q$͝iб3IOBN+ɄDn&Tf0#Q*#)ς]ٍYmw M+bQBS'˧kN:TZ~Zu o?I9iE'auukfյRdrUYOL<ʥ%hлgMz, T\o3Ƒc+}A#kr"Ǘ J}Y# ӂا0J#'6W>55ϫbrA{w[[[FV+؍GpEOQT \% 4Dh܈UV7wwRAqpF;ujj5Irfi@kg@MME~}G*;8l( kj$`GȳA"r033{ZRu5dr0l Ll,sUPR$wUUߓ{ufp[Om͘^99dza57lj\n=z(Ԋ i5!Τt,F[ƞfQ;_wm*/ S>ْ!]AqRPTöR>[:t!\aV- D j,!^*Z ?DDwo\I%&?a V{>?},(!Qog bjhIf.( BSedn E.K^QcU9\-_>mym C&|:#V#ÛW}e/㸷ɵ5Kn( +!`9jc˟fj,q&<$A6A'3j%1$z*ꋟ [?t{WJ(,Gt:F+ZЛ`: հEë9ѥ:qJ?sd8$-;HztR(@< n{ow!Nݼ9:]5K#4 O>Orky hn#1\Xol1$B,؎`ʱzo@LOW"D8G: HW'D9d!+^Vʨ5ưk\}H:2<幺-ƙn.uQۨiNIߐwߺ\ u2M8J云r+q .7]]rKp:hw Ycü%%&=CR/.#DyY"$f>}oPGxvl:ԋ-,iE=Oxlįba1}+B9<3 86Y u] mmKsc4_n^dN!&9lR|#vEJ=ȉ-clTx駊(cE"iRdf^?!lۗo|55ð,]/mo}E!\b<<0{Ȃz#!UZlRnʳ1sX$d9At ʋ1LiF9qrziwھIڛĘ%`[>-I@f Z(bUiBdBT!𧐱?R-v_.4Q9`73-ͻЇVeE`C:j=xʣM`9 L60,wtD 5&t2)rp"b} *1#b~ 7µ/V ]c,($ro zDnړEi>Skiu*6B*ʭJ SM3>ǐ07}lܼW3Mܔ1xjRQF+Sxp]ۮs-af\h0=:8KV LI o!3{Cry WmZlA漒܂1Ff,Rs"*rFj:uol~nI%۱B֊dVL$$T~+Aֺ ;Y{B⶷ ?jTXB,u֧.ص.;.$Ww oR]PGòlLq~ucf%S 0 @1$8;ZOV <M{۴2[ #lAM "I*9 MonݥwÇ_G49$x7RkmS]}Ŝ9a%+u0¯F19^mu]]Ѻ^2#lLӞ4a)gݰbI'0pN;r3,vCEvv̿7c&ǺQ}&La)qqXlTl sNǨ)Tl% ‰#&XhmڜDoٺqx/+nYܽc#=ʽ s. %a3_Hѕ&ic^$Zd6̈́6"1_<5Kj)-̫dZ뽎˿o)U]l#a:ȖK*Kc_AZKUOֶ4 a)ލrqwnZeX; U\( %Jc"\$|avDyll BQ1n˒cmbmG*Q&|F˻t,Nvh =wy]n}<W3:clщPG"xAzdC=]8Yg9% ʇ\[\M\d2~pvDR O']69x6+(s9 `;xℬ.(mVܷz?OQϯT|'t]bu;ư %A|lS״Vh{f,r<<3;!ĭm,KJ:fbB|SނLVPc9UTO{C8f/x_EC ;iYkWi̔ Ror^kܾ5݂{)O4.W$:8vkpE佹n&bK.?ywb~w{íiIy7Ya c˟olLʪYΏ/֬% 2J m4G\VĕC5~oqZ49$&-i8%օVpk_b2x|7-X {OgWK+Ryg3[?LMVڳ=b.ѣL]&pm-gfyZi&[Y>W[vɵnӛ :X>W;ȯ,H!%6(cT ]\LLSP!8 gU]L P¼CG#adW \.VJ[?g>"Ti4.br%Q&M쏁I%24Τ4]%@@xIe'Wtuʼn>כ{ 85N{!H#((Y+湬xf"u#KUd_CKIl6B]iiNk"5UO <8LGE)lK)PTNr]m/ rO~xn\_ǩdR<^KYS_gm < L?9&e-[C(qwq.+Meg՝dN +ҫ=OH`#/$A3zn7TOSP0#Ez+#Mާਂ|mF[CU˅ uZUGo~Ņt .v>(єHEi,m:B'>KLJ?s 7>ltK3"s؇P)]4&ݭ{Gtl4x2FASw4]zD67&e6<`WL69]@`BkL!C)E|r|!zυ~4'c=5S)n2M%21Z/wǻ-)>}ЅnI-*]Yړou4Ѫ,#[s H_\e6Ow\dX̉$ Y#C2,3Gd4Éf{.Cv W$M2(0K?2Q1RW:6F{Ϻe:k4\cVQb"s34F8*ƪBRs|~#'ia}wnqz%s;eKd(pۤFm/vv^-|FJ_y\Dj%N% TGgXNXm=XAff\|Ne6-UÍia+bz!e}vol)KTйZ%>eϭ`y> q_,D @*J hh6*Q teicð~!ĘB}$1x;I"8 ;$X@I"XTaH ]'^Eb'ż[@n)Ec.g)ǧI/H$h̟3GO+>8XReR"5X[nGl'Ϛ{:BDj4j9]1$q\:Qը4>* yx>X9(!H&uk Qddw2xZDrre|ro+(7OUτQX[jE)'.?Ě9(΋-eLGy ˆTz+[Ut)§>;Pq=gDgH|1CH/*V~BP@>Q8|y6!6YZ6|vO#(IOetdMU2s9 wD@q@z c\jEc_J64z2sqAsf͹k6d;~ YA#!ͭoZbv U6C!D[s\*\P!]0}Qĭ ma% vvq#3?逨=Ϲ9g|_jx5=w=v:Z:VOqL~@knk4ƠM:}UE"֤o Q#SqhXQ6fAd),a$p$H`]<*&_3cBG4cK{B 8W:WӂGv%6 YR􍏹z{t7ԭä ?+ű9&'MO%LvĤFڮm{,,DF+XtbXq$D )sӎl nV!ArXŹcG>'G@6֛4-.Am|\9=sm{K[Yf4*{1"+5[2K~q1]Kv)fqn@ט1,rM^鵴)^W7U^z|G7f.CIYu3hoqn|65ݲj6u $DIܟQEmwٟrL~T?ΚbAXAĊJ֝8W[1vfgU%]*Edw)*yxdIlzWZd;MXkGac"~nr!z:W"'6niph#cU K'H8 s0ŷ`ڍ.o A۸.$qwv嚽 tҜ`˭vvmZ>8}A[1HÞ8\@fIM~ k]ꭓWY(h.,$j9-ZƔHFY'9xam456$W,)0ՠnt"µ8^6_|vjyUZ$N$hBG0u#Rjk"qh0rfI[+82C-{#$o?/KzU8V/|8O ,@nH?_үmUSlZ\|#4AZAC#{r/Qr*m-"|||XR㤨4j+\~ >Sd8a KYr'Sȫrp*+ͥhB8UrG,0ޘ5EũѤ\*fg9W&,Jz"xZЉܷnQǏt |_"oJōGWi+O ϕ6l,·. WUin֥1U]'gUbEߚm|GFbA+ygbcZ5^_CjoeNDch@H<-󏐱;tb ]AJ« Gj4(q"ʫ[MX<_7Ɖ6+bRN2Vw>%X؈pLo.4 q6Ko:w(ɰmuLX*d2ȝaiӘxьc^1ߧLyN2 DK]E#1jt-LvO6@ehS%c4TP@jMtS?o;9;̓~MoK[ljh_)AJ0J?)vǕ2x♡Sumf]Gut^؂aT4˖wfO)2R[VhXv`ch4'2[.OF&5չqV7B@QVBeO^qHWƍ^X"|\vc=0(1Lzo>[WAyT %;ׯr)/-mq M8^Z2L^$7Oc()RVŠi,#_[w+om۬3m/}*|֫p&KW]Gm$:RdN7[&|<^L ɵ@ }]վ --,26M@}H9g #SNz:ٸN'cc. e;6V09F()p,'O8DW"y9},lw?[Y=[h|RRM&w*"Dd?Fo2m 7Yyha{H##xYgV?.4n<(݈jWu7rVv9h]cshp`?5V)\;w S&X KȤUqQ{`cos<'جu4-N+)\ Edg/?_n擹I4<[adspa:{. hDW5Dc'yW{|z۸~3URfZap0Xe2j,xÜMx` .[l[ anDȈ5n5H5*j8 _Hvγ)MSޘq4RMonjM0UcDv'䳳kVUz fxܹ. ;Փl*[tlz2aKQAΚ@4sE\I 2,+tW&d"b1z4p[Ъ|.g{QϷ^#᷉X$kRt 4+KXOӎKe/wR[+뫸nRe2$1-©,|H=}`{Awq#257lkݼ2-w,+K%Z4R=Q)'gr;C=/KCS¡AX0 ҌVL1!h䰍rD^f4۹Ibw8V_hHO+^e&{FjYWrp#RyAkQB w 6P`+2,̦wfwD`bMTbŏd!a2p{ bc-c5d闶8!#wWX;`B}I!UO//y7(z DN]OsWu?eknG$/<7ȋ)a_-"J x张B0/oO+qƜϊ:Bs38{>^'yx_oxN KU "@˝C_҅JzF2~\'Uyd} w$; tճ= ,2%J7F-XDᱶ{Kv,YHi %VVPh\O%}AME\nMqb1 "0!1e ;p `&M_]ĕK0V52R)}Hsl"DVfk^oA~7Yw6smVxV xSX Iq,&gXbo F{ve1,ea n&Y.dxyV Ѷ8tKnQ,n 187Ҡʙie(_U$k9Ai%k!ar߷Z*R ʪ99/To *?[ S} i N9W1Y!j8p\NSQW:~-?,HkX=Qx#U˞W[漪q\@YnP|X\;.Q??E<ھwAڢO%0!{Z,Kש黩:+>^7u ®bÍm ^h{r{Uϟ'ǔ'G dCHPֵxӦ_\^[_N5q*ID0DGt7 yx5bؾdIespÎSNI$63>Ds<~8NG%sl(=(yp7C/8QYLCfPݿAF+ȏJqcr--3D¬rՅ,JD3-zJ^cl̪|F""p~ eXQA?GEx^GKǒ3e_Ul/Sy^SϞ|QTxGҪU|>dO&I+Q^y~'22S ܆>0YUò5nP6t7p'>" љ:X6; cxNDߙ<՞H>9zs|cL@29[HS'7tx,kz1,eri>c9f!B G7cBr3wֵ.>VdۏnwLpcl+I$v0 #3 1`O lv7[,-VvL\-Y)Wy$`*/nZ `m&|6glQٖקe9 Ҍc! إTJ͎~GdyFkA%ɔ\tY1'D[r'->`Dzӆݏ}ڭvouE-奔^)< <#+3w&w $÷wGwgV1e Vȝ%E0bDx_!b:*$[ Q+_g$ ;O+s|E-k`h/*\2TEA{zZR|/ȏpJ?æ5BK(>#ïFR?^ryc`?;ƶ;b9^% ML6Q0kIù,ㅍhpr}H8?hj8fj0ZL$ȥw!f7;>",`Y|(Lvƴ|3 Kue,'F'2wdPΓ1A1X&:T#q[ Q\~9dWyDrUXP":q$EjyLZȯY`g.㈄ܣJZkn}1ˌ Ucָ=\*83$#cμ04p#dxr䷮Zx/fYUV&yj47JK/w͕w+-m{0dCpY$fTk}*"HE]vym6Х73&=q)-b,,e<3nL!bAغ3"}lvѦ=BII1'oDy˥76ܾ9V[v&9`t@"H*V5mK.QqV{vP A5^>M3{3YL m}wmSԱɏ^CĪcJC M|[kNV\ƍQ=VB~z[kxkZ7TplV,*Mlɐ,P<,΂|c1TOoS\)2]KY2Gݾjxnͳm}jcpvۆ}rJXngvP\]KGnUӎߐK6ֺ8V)V\!*+\"C 6Fݙg :06cb9z'd!_056llSlG.crO,5[wyHQZ\Ǧ ,\{sx/mJyC}h$akU&rM;.Su^sg uNNswOjrMb@:/wmp,<Ƒ5ٜQ9FĤؔ#7WB):])h7Ȍc_&nrȜj/<59_/U$vTH=?kY2!*:}# 6ʻK4{U5/aR+lp^W BqXOhilIT@~9TwÄ^[O?4TRx d\r/tӀڇzQF>L3V }E]*SU_Y9y> jσ;{& .1Drd? ;ѹa+BFsK4s 1>|y!9> 7&?-Gy|ɼ'+>%^j22¯7Ž'P+\J(F.ZkWQ~^|Bl"$J\ADj5yb)樟آ,•>7rUʐ+2;).YϢ"?Zޚf;_Ҍ.V#'R pnoٻngė}?>;H#FVjr&2*<8y7%=͹k+tM.anM:WA{C߱4PmZvI}ݖg!טvګAv?Ro&kNQ>C"kP"}kyiޕkѭizQS˕Z=x)<ƦK99E.Q'GH&>s":/+Q SSǓ";Gt4i\;Ŕ}cUci}C]$PuI%)Čkƌ: xr Z>9M=JQG3  *Hڮv;u3ӧ#9|#W!Qϭ>=>w^5b,akG2|QLY8%M)6k3C[\U3c)h @>Sr9u'~;Fӎ9R1ɇ@1[ E4Ə)t9CтtF5WLkyʨp)~Xr#n5$r/ ʯwO%Do"g<&2(Vg<S)ظ@:LT)"@9+Z$wW #| 6`#cHXD4 kia220Yvq,S;o(}&Un=XX[tŜGM2DYb$(vg|و$VjXTRI鍅ܖ=679W8&3ToWȨq,r}ě;Up) v jˀR^t5H I;^RK<پuXoZX϶xqV (DkZw K [R x #F,K7Rz?2w[Qe Vf̪I%E MU4'tonnM˕s Yklv8>XV9l?&\c[³Qm,)Tb=L6N<ӎ8<4Ґ^Y5NI(3NLSʪII+%%qXG+_-^y 0+gz"+y xNZ/*M,?}>4&9VBJGPBGB;EP "`x 4D{Q-UN>+zz~%r&W2akjz`#Vucxb$UW/ mdv'umMm4u$7jgMFD :-O;cx 5hehqV xjVBJ[BO/e0|zxu_bKz[gpP8' Ngsdڃg[Hٷk͝VVCa B)ȱT A/ ь}0P[ <H\fGt ;H_\T `VƝ8,m[&H hI$PR?rFϰ[7o0;@Ԛ(~;TI Tvvõ6#eX;VAk>:>TX_2S<ƹȹ}r1_͇(Dk^>UO3d>en.vH!t5J+CV ?w5okL],l@,d7%1T8]G}K2nMyQzs }aKt[lVX$cЬbl]5RT@9j#P!Qd8qѰre + \^UyD_";+!ITxΆGf,JBnLmDbBPCed0k^ x;D|MѪܟԐq>(=#Xd "A9X1Σ}eRe$sRDD_oגq.B<-yFqq.#xʹY#epUđrA>5NlO<ᆚkO2n9'\ݛeR)ed#9TV֜m d &3@zq~9EiO 9TҦy_xzoF*o6 2+cc,{{:Hb(c\<ڱ9-P9F^\/.k[ pE(,IXYd\r #V ѐՋtZ3Dk&,Rk"⹽#1: @Mۉ=紽)O'{Ԛ7-YosдwG,2̅P`@FRzV1eoSdMp=(Êc|gޡ:QU9 m$ȑU1ujh586VcTng{!ڥ7J]sӲ:AUAbıyNuD<kܞArl>lq"(ĮJĿM"gyd| }, {<*KZ\&d Sdy\ޗ*"-_ }5\Er'(/?"i À+)i^nZ +Ԝ yk>'mZ~ "|*u|,h)_EͰZ#BGLGTT-|;O4%tF|o\^wIN|ÃhqҾN-,!$(5Pcw pA3sEetrGG*'Ôͽ5n15~OW(2ӐGCV1?l|yUoݓE4Xc83$XKTH񮫦Ь L9#g+O-=m);}ә۞h9񓘍"\$D98̥Q>>?n}e2VI sH+H` 0wm^5yuMV7ZZ^QQepi1y 2pB1i^ƽU˱kIvIe ,Bz΁[8j=:E#xK3}jq{.tP9%@,3*ҧK)ECy_!2=ɀ+FpuHLLM5> c8.&Į.zɝ"3Ϸv7_2Hxi80ErW11j=*/B/<=F)|ĬUO-d$ƇsZK,n#^LɩXs-Y^ۏLK\ߕg/CNpJ|>ågÌԍ__cXXѰ|w"cncвf)Pp,"XMLEc L XWppyUNEOysf#N+L+ˍwwm͡ڎv̈:RlY;mHɃoc3cĹ%eDU1/Ui /j%QyF ˍԫT׋TͶ^53Ҙ/g *vbuI6niRva6G+c1 {85aM5Xes x=u'5\ǣowXlſw5 +)HK槧 y x`Ki )$R{dAс`f2ť%OQb%cu]#GI3(7_TH`޿|6a{-I*uD*3uƗAqSRQ*XF,jQQ4D`MosLJW/i%3,X*ФUÆ/wog_dCg RZ2,3VZ5Qqϕ"xw7;糘lXh`:)99WL;[-c$rhx4qN[UX`MI(rMvQ׻O]fo'8! խcHg8O(4E8&%U: Hf4XI&YJy&XIVumUjr {{ l%6,P@SAOu-ј#Bqֽb@$6 *Ǜ4;C?}Sdjqj`K^~0i9 exqRD`':|XgJWsʪqܮ+pHI%qT}GwdO_,#q|UF%y`փ5̘ kY[4bVB67uo͌i"&VFQ(@p-=ym:U4V0gYSI>d;Qz#9ОǎTFsQaO$r1jr:|8"y[TXu}ww<ɭǙ 3 ^e^QFC5@dduy{֩=NUTdz.1l‡&d SQf>I^AdR9 ؞X_lnMi`--o#H4NF1{+{lo-Òk{"(.̨F)e׫1mwv͵ "- E9G"-H^ם( rdkzbofgJsSy^pTOSU<)<^?\GbȎPm[Ȓ$1'ZF?g'|..gIZV_dڲ=yb XU4R _2=C:=^*Hk.K\rbxxϴޖEieH5QG\~YYO(+ğfGĞSܻد*ZZIp0Bak!Tib7\û}[̶Ůh.V6z_HX3}KZBiS`zMhw{DB8m3}RW+U^9_ 啒茲{˧O HzH<{YL@Cs@孑aMc!""Dӏ֢cW"QQTTwR'_5b' |<*Goڊ3L #+R0:%*(#(kR*JOW UJ%r+XW*#yj5UynMZ}O˟7H@WI3"iocsK#Ql{bp5C?pEjAsڋÕxU'9qyy-qF{~AHB(s :B" ZzoGJsm_vyH7c\/t?༪8!=yb"^\NTb8H8s%#W:@,Y$Q%gsw.bG%Km"ٍ"NBNUkQ:\+ wp0j \f>OjZJAă*| ?Dr Dr+UQª2V+'=\Q r2zNJ)17lll?ˆF"5j HUN//ckK,iv:\+ooXҤwA([;;aZa3B,c4/HbhSV\.^nlO 䰸~aӰ*TMJT>#1v.2T5!lszN19,tiI5E;1$F=ҿTx+D0q,j5 y_<$GO(@OL.U^|n]w7{pz kmMQBI0E8~QaƮ79h-4]ޅ;cDN *i@iě=yMnaY |zr,--+%!ZW1:  PWFr4abX8)d$g2KWG+΄sys#o&ܶX~2J%EPC1f$W@5d ߹` [sKl1kC=ΡѨ'֨ȡʻl'} 18pBԡ-{e 3*0a+c$!5c8YT_UD>E ؄z7m½>UU54PW+Μ61w& #BjP PȕSNUgVd1[<ѫc)#=d,6ųX\{Tb5 xNaiԍxU Lj{~#ЊhZʧCoҴ=i%F́^$hbf0f\)>iΔr/=Ziܾ@R5S^Vnj^| ^99%3"$7CC12¾ár=aeE5ȭ<ӟc sG\U]>3\ty}ӌYscJ!%T\Kx%Dw wJ!M񷎪\ގxTkWFpF4O><}p"U( ! u%V#ZW~QNg*_*^TN_l I4Vƒi9WOjby'CUQ#SOxa8TW(29Z;ڭbZ8¬j0'0 ƤO5T843,jc ]mt3Y R &L(5g.D^xN$KlAH֑_9J'Z9 T^S~YqZH&'#Z<.MvȎ4uaG1˃fwaUcu^ uF[*¢UVTmkl* 'W̒!Ei 5w(FDT#UTTw(_ֺIǂTC<% Sʳ>!la"BCzcEFԅkZ[W(^%Cgu"pקR|STS[%HQT0œt,a^o.5xcVKF}:hF `$J qsz՜H#MZkSڇ_DA ].d|8grrALImNHV2. dP'jbHyW /"'"yUyT_//^<VȨd35}ŊXuGsٖ;q}Em]2k C0&̪v^ò']d2cزd)iZ@FzyUcyUw_(A5ˀj>wtD?Uwi1˼?Xѭ0*܃d!A}eyl~Y|ũLt ncK%~E -a(ѵ$YڮNy>ToÓp,& [h!s[iK ,mu오ǜ+Om0e"蘄48٥)kx,!E`L"T7jfevbu}"%cwpO{]:yVOG[HTE'UŪGf7Ҩf5*hq3X:)T$`l[iUo J% ߳TǦmV6=r!@"[B yf`]F[{Kq|)oqoq4.uy,Ʊ5%Os7-m8c26IGSBia$h!8u an:2$C0yMGj]3O < H=xMCiԲ-H锓Wd#`X)Qaȯ&Gs)>eER">Cwvx"&dD63R2Q8 kbI8ѵ֪bPduUfSJ'h$;SՊfa|_Xemm^)gmM5Ej 4j\-afͲ) w:*9 +1Ǩ#60 '8E$6 a$ןJ?6崲Ya "}R-l=jb⌼'O ¢*Wfl?Uc,"OLzW u഍d&c5{uHVa' (^DE[;=eؾHBi$n[2e8\&>ծs)kif~JEXz~J &ǶpX5iw4ո{j\N"@,X,"`18R3]O#!ۤ>ve+dUeDTYUU1#Tp{؏sFaUEkx0_OL$W0zAz Cb>h+n`M*̍` Kh<6Okq.iek[ Z|ڎ)$BQ&W`"ML{R$LpFo }Kl\ |-ڜQ!ʞ %YΎ?AXYɶiܕ?qSښ^tO:nn &77'ɤesML!; 3q3{ePswnYgjKe+=Q1ݫھ_G̪r8Y {c[PНi vD2 }*^D:Z&r68_>WWe5xkZp%\U88walr a]9VQ=H%ojWz*~j%_쮚U4^ca+LAThzԖy1QHƪr*KG #!?k8[޼W ^8'0%f!Tp! w5|^C8Vkic:M{"4=s;R#ސb/)\x\r; ̷-lM*l"Xlq 6%Ihaщ{Ӈse҇x>L|K@QA@hA1dGΘLV6mqcVk=rFRun UY6ZCwou7^Iىbtћo+[[d͓߂IGԱv5.$А51nR A 4[?e Gj }HdEXִ񐪪'JǗFK5Pyzr*=8ht=j~w\"ɲX %mVjLIf)'$c$TB5î09ż~T5kr5I8-^~?ޖːNҩEb99^VڹK)ȲY RХUAfJEy4>k*#xƔ9l^?mo:t BE2Ξ]{VvyMnketw2}2\ zxwGz#SG[ml{ qCiK Ft k‡ 3 op5޺ޘkK'GnGsjyA{k4!d53q=mUOZwiy-n3bSfF QwE?ɚ/p%pw͆F!Df$iq @*Q,@9rԌEO I4"#`9PzLjE3I5S&xiTnikӅ.MrɆ)kW_-caE"gkY4kD詬/70H ʨ&k;n2Aa1!izMJQI!74P2$Tj):P1/(TFrN~+~35U}ӁK2;J=$hz{*"|"qs8;pUW/3ӏds AFA$A{xwOMsǟN"x]þ)>SI4CwCѪ*c5>(1G(|QDD^Tq fckY%8J^Xo =kHwQUñܼhԪ>HY d$R:|>#w8A]-HSr#ij?K \p^{(Qq}(zdž!c=F~~&u9"+U!WUVlEo>^\ÉSJp_y19Pie╰NǮZ#,-j[ VoAN;yNy(MV'$zV/DG=rq񷫎RW[е[(9${MUJA]]oD51zʺVgxmYWbrό?>uJ{wUbv._$l#hdSƢy^|_EhRéxUV+g>^ط`~\ǶujȖVZ%7LC6`]dfEΕhA^'aK(nU^|y_$-:^7*4#W֟ſcSP 76&.z@u>ךحRvF{ Q8e3E1(6z~1^6' Oim ӆ:-Z`4^ڨ6,^Fyݜq#!OAUyZUN>:O!N|ecӗܣ"0 cPg Xal/TdrC S+&Ɋg5jz"1G5<**\a&'PQ9WG}gy6k7+kUl!;p{S*e5gAqմryl<J*Ca[*#Z|zؿ8F|cC+pC}㎅Y BEcQvۃ жo/ٴ3IucuKYȲL 5W_$i1Ίc*#Χ \4"7*3_'XЈ:?` H+,{Z7Q;Ta`{;yxʺ,N:upr8,v ƀ @kQ9"kzZ֪0mN|Q|Ml `r񪰽j/EO_ׁC.0|J{긤%oC_'5zW]0e:O_11 М/ǟz^8gf>=8־sazo"j'grUȍ`ZކGD$FyUQN׏?j+VI;38'kn=lUsCB7F1Hb1Fψe,jÔ.JGUQi1!cW<R2cswvа)@º`s =絸g. mQcDuZz?Z1@h ;* gD0_=8Q؁G<k,V+Ł*lj;"w(z5y_?fdy31wS˧3ӄC1MqɒIXgv5?:r#q[mA+9UPBJ++1ܬb5HM޶슙gUY.SD!gBY E#X!I>*Tc\;Gqmb*SE5tfv d&ON|+剦cm[XUVkZi4̑:q?+s3Oꌳ!ayfq2'ۘ63 +g^K,uO K2ʳߧS,kQ5ɝ|1dAa~m殺l묋^+$W__?]%txΣd]#0Oj=ܸS@!/W;_RH$,"_w6# a7=>dD=YIך-Ȳxs(p}KijMβ+ m+*M[!/㑶2){RVSgWl (qUt.Y8j1l~Nr*xlMZpVtFU1ίK RCOPb^7o"?.JB'#HK3Z jX5vۦG׸a;Y~>=h7oBp (o#%Mp C `3iEn`bA DUqzu_jhHɼCݙC}5I R*P* 2}tX̤~Q3͇kAՑ{eUYYY &|I"mݬWjj  v)H7,2Ƞq#Éc}muw긕Kک>&!@.v`ŽV]]j@"/wX|~ؼKB]Nх+TP3Z㞿ʯvxqSQQ9y.5}>g̨|O^,Y+GHlHC#kʻʣhFDڴnɝsy.# /-ˆ6RH(CJ<>߹ܿ²,Z'8xcRIb P KX[KAt!ikۛcgFftH\JኹJV*G-wxoUeu ;,rz&oqJYv6QS5lĆvDkB21%P NX\EEO d B= ~z:qUI"p0ЃS$C"3F2>\y,qØDG'>j`V᧦֕Uw^kO9O9:5UV6a_4GO;o$ S6DX:@"XW:[tA"*㚎e_wn ؓm#XTU9k˨ncGmۀDp)_)[NǶ1 cduY ISr FB{!'ҧsAmb擻2s:]$ VhOKY;tί<* {n-2幕 +̪>-7g%K?dQ,V8B(Cr"y,k8FU|9,hp'Ns$A:ֹҨUy_.~!WTc[sMYaW&Eu9O kJ"5ȜETNxq͙٥͵k,t" U]O5'=xy'ܧ|]n^ڡL I9#r1"']iv&-`g$H1 4_ވ՘ Nu R_m)gasvCk;'ҦPkcKɀb^(UI}*䜩k aGkbY٣}oR=R g^x%X"pz* =ĕg<7&X|%au\YEA'MW(ʡ$E. ۧL{2˷,~ YNLN6J2Ě)t9ct`6ՎT#.poY 2K 8ES8QJP*Q#ؼ&V7EȂ]:e=ZfTVЎ2}+xǸ!&;x$(Ӆ1\Z2m i" *ބu6e!ŷV6-nGlBl<2K YDt )9HŒOj%LXɊ%ҰlXJ/-? i&r_Q7>7~+LJj[Z !ܠKbV71 КnoSpe%ubh|EKe0*s"͙K_wR[j)B8d HUPsFtkWc6f!<&YFy$D|UWUz~ܑC=F('X]<)uݛvLY빯x12nf8qNJ*M8mK+{kٰ*qO1j1~ KIS bF`3?ko-k2Q\/*֧||jO K7͵c+؂jXB̎O6$,H3ΨbFF+4zgw 9Ѕ:/3_N6 Eszs=zGj'G=*0mEGN\^_/]}eW>*iD,v !I LJr=׵zyj,wǎwGTR% ej?yK8dNjEdG$ 24%J#؞Κu2C&܆WtGq" \G3YpSڹ:aeC;R>|{1abT;%>\MDEƵ\0Ԁݤq#~ḿY@Q{cAy*`ϫڤ)Ŀe`H֘#$S١}`b8p+=/C) PdV6K2|`Z)* MlKpZgUjr.QǂOa6pMc;v"ݞ52vIXE8KaxL-]*`S,&'IpWDUJ ʅd 5] NedKKD+$G) 5"9Z֮϶5^%O0 - R,=uxԸT7q()ay)6^/eqqyj4ҭ]8FJt? >8LDӎFFS?w/v.J"Wδ Yp_5^IZ*v/<.8sTUU.X"/+)k?x H+O_Q_ăis,N|ذ|{Ȯ67#}寖+|doG1NWrqx2{'WbhӂU>VƪB6w )k_Gΰ=[EK<` -W6r )1 eB0 8ѮW>^zW (p]5{=;O:/ bԳZcFl wfdzgQFIRΌ"%K'A<57#B湍p⧑wrR**8QF TGIi?Ţ*6Yz{?ZK7?4%-.;idg60LQID! z'aQG5yǵU/ EUDr%9xGU4Gq?ϟWifIl,4Ӹ:Q &{;:2v"aY``G޺**#-EsDED^Q<͌@\9|kb0߉ JQME'L"05b_m-}f]6*,#i-'kz?q:FKQLo#ފ-Ny?]J*#>'3)]vgW7'~=e]l{\N=tǮAdXk.Iѫn/lDt\F ą{5$z[痸Hp/6MjZs#?qA׋dowݒM57k?kiLfbؘh+;u.)l*-OuH^,l{lqG=|#zj״h?2F>_*ЀA Nuл; `L[ιnQp ðZc?2g&Av5 %\H؜IaX[ k∮G;,~Fщ3L3jQbq,gՌ(R/%oayhl `-|LmCuo:,21Zy;>;˟b'lvsk9 Wh;ַѰ( 2HW q9Nl_O~ܾKTdA-m^WϻMW[wgd0rۅJj8Eb"G i]g2*IURkPh, aOPcQDDqmo5Wy'c#"L1HCozkBʊ+հ71x7xs" {-؜Zv(0vi*"WoKv7n{}'|uƵܢ:*Ka>R@ޛ#?\W&{i""#xqIgw 1^lKSׅFrӱ,Ě՘ğ$y.-nYj./@qqHı˒Y)Q*KjbQ9IJ2zIY+hcqUY\5Q(ؿֈOO?J3핲hɂmLG!G !TIQ)M1" ;|=\浍"3͝H ^KdrpqyNZOj[xO^M6/tw&7^Gȫ>x#^~n|_LPœsm?Օk9%45q!]*09sUK1Xvcf@:h8,Yd3+<6&K̂8碅4*{;$zOD~8Ī12[ j4BbVFD;p \b ~qkacx| u9 \긖3eDQ0 $QqPDF֑.!n'wpXL9g[ű 63Òd9ِ0o'.f,1Hao=1VYz istyn7K cY l=ּf<rنrF,h[ ywUR΃ոH*E2BZX2HOB׵]L V+(c: zZhTВ9|N;KX,,m1Qc J GXJ~P(R9Xf^&g{l;Guv5T6t'3^YK1Mfάȣ1"xǓ73[YMgM"[UŢƬicCkk2&$6髗"(j8 9u$SS[ s0`=4!@FtƪhoOt֎N`ܖyUFg&.'p<#uc h[-Ƒ$W\U7eގ=mt0c%NF<Bÿ0Y!gT{ʅ!rI-mD,t/b8C?oܦ+;LIIF'@S'l)n.v7󋍎\ŒֻM}A$H |us!pY/9s^+HCJ|OawR yڈ06s#+sX$>-Q)[ $I nQ1tf#X{y;[ u67uf{0e7RrD|Xdd;%N aaΔ@+ƊcnѠDF" o%u?#zQQQQ\˩Vt+^^ Oiq9j1Ӏ(1}c#V;$ W̭^vsʈ"q[:aqP:YSE`VsZFs1=X5Bzd^>uHNzֿЌEp窲;ާEcWç4$ů:|O⹌QX>/ylL⼔Ѧ$|f$- ۩$ [h::?pU+;[e&(@)_5x/h/?7/6 W g5 #/>P ßGq젡ӡ l_@BGgVHZr9Yvƹv: #KJ;2LriłG* ;^'Ⱦl:i*#}ҫ8 GR }!dSwˏ޸-E'\^¬(%J3Q}rtWuF{dY5VI`vY!$,3f s_ e-~R39x{qz :LR1 ȍkR;\^U:y|Aj:3ЕaJH |zu\[,h:HBņƙK0[hi 5IIǩ:zSU=ᨎUEo]y?y񡒜p8M@ިJQ1"zb1zH\>?/ǙNW5[DFxOu5jqk=vƽsy`4w-Uѝ^h` A湤A*#W׵zm^yDH:yk=G UJ@OA84d ,Gf Ea׍"1WN8EJL{ca77KXԡˉ Ee[2QMlԪSG [w9{nZd u,hbF=3+ZE(>|)| cN-o w쮕3k˰rw6LMAx@e*SeZRA.c[$a{GEc1<_ +H&>#B_i-|=y|i S7W bz/ףU}6s_sx"y"y?ǗSQUT㟊'}]8%HoE\VG#ZޤiX(b^H)/\CVcIQj/@ׅgS *T~4?xJ,a9^\.>AF$U&X#N2Vd!^C<5ص;hja̹աU 5|H JWUQ*xYa[6fo/$[1#[&J *?5O ^2ٛܫ;Ņ*K%NjLyF4*q]$;[,dĄWI`vJ'GP6G5.(4Μ>w͋.ݵo.c QE ?5Z`όdY痏^A=ua2tYWPCKG֚kŋM$sFyc(U8G7|c724ȪxXJ`1@K=SLki*'dޫQh|##y:'R<ڜ WjKf!ZHJ8rPbԵثf2CDn1J9NyB&8]F3xe^j/ Wj~~9 jr)ƚ=*2c8({kbQʇ58s5z=z\__tG{U U]Zz1 I#fœ[$6 &ibǃ̑_2$y(0+VU )4QdQB iJ1{X✎Q㋩\+ѭwېKmԷ IRuz1Ӆ~ނKlEa9'I]@iO@ GNI} 60+"eemr++r]3yi0V2#\f!|D2mOn+PCFGC1҆8ub`ϗ5}^ׯq#QxTETm7Kӗ6Ҫ="Ko$oN\ή^ZPX?'fwY3elYFֻ]qoAvNsd!Vʧ Mc @z2^ThyyDJ6fO:!7"3iC=I><=Xwy{v[lw{r0*gFL; ٔrnO]]"k%Tw>YKqG;b$i֩Ҽ yldd4 u?oTO_^ _7s]f;aϨ0̾ƱmuY(yLH6@DbrlPPTF+կjH9<):Ũ x#ۧsZ=/sF+[EwNskkXeж-[~4g!5҈{xo+kDJcQZoǟzpjLR/ ;sTvdtX]>"cn MI,i-{NYkVZltx#Í5rsp@3Yk*/FNMZm2.Gj* s o^\G}% ?½8)YG؇ޔIWrqgbvvcYe6;fpKD@y Hs> +Zo)̸r9R4cΐ(lc G9Z#QyO33<"k+򜆧L]{qlXjխl$oKDg k76FXl ;IJH+UĢכrNj7v'68\<<\I&^2;.9G@őv 5z).%I{dq\ [SF`}W-LR_2º4C$MTMUiYJq1/.5Nl RHpRH h#mmP4}^l 7*s፥<-Ԥi#U Tjj0:qg]9.Yh{ Y]"\a-m2 0ih,h;}b2f1Jb*s]spoDUp\8Y '>J4oui.b/O2G-'҄WOߣƥkʄԑ.{ؘ|WimerTGŕʶ L:o{<2D/,x ]0a$EfIA=Wow.U|k;eNEsd9IK[EBATzpvEWJ:A4 'Sp)ߑ6tgj]71:_muНy ^Ya`ŬR]U׹|i) FD9e²pewzRfZz˯YZy2X|k컋WTE!6KPFgbʪQNh[ucCQNt^ 3Yc2 Y9.+8>(<͸.{=oC@.v6b'lNcIzP=pjO#-,6/\s(l!%BGG"+SGѸmsO^"vյ3'ͫI]iW{aVD<`#G"ߏptu`XhTR9ƄjTy*i:w<žopⴰ1wĸyO=qF O+q): 3`ѕE:9_ߑt=De2qhlMK+(ij,)`&l`FNZ[7;qGecD"ْ{G*U%ҤSׇ|mF sv@ <р4NһP.unh*e%ocUI`;ߩe!9#FN5\M6CbŝRE\̎4{6хcKeqc2W;59s"QAKXo#e1HSU&9&doFd,A&Zj{y2*%VHtijY˅zْ"7Q4V+b ོ"3:l qXrG5UDW7xĞ^h'>9)}uĈUGulbq0Fct8\yG/ W9QQ<Ӿi`9-evN U̬h =jrÕEjAou`po Z=I4K+rqLAIO/!u6~ْ 0JaZR BּQޛklky&W+Ip:89!0,-9#q5w nii-* \Xg}ǼFNUEF†?yZ /vldҒ wהZT@ןJWjO)~R^*]Om ~m89mn3|&YϷXm\ 斺5exd":=TcR'7$9E:>8m=FxAk\r8mNU|,6oW>~(qx2FqZ <C<.7>"\UdkPf!@G*pF6FH\(Wg"p?]wQXQc0Tk|Cq)M<hC>ٖ`l1gD;=E^z|||?H@zܸ[Ge~uܖ[TINwhuQVt0? EJ8>ϝ Iೱ3-lRQ)(%B1^^3Wpr""9Ob?]!#VPXʃ ʏsQ(|VWrDGqᢗݘdxNױkUݨO _N^xKs..XӲjTM?X@ue\+(hϼSOC>jII7K_N 9R~g%6}]IȹƬgb- ]LVsֿv?ӟOyk/"Ƨu6i} x^y݄"e ( 7ex-C(́Q6(sa8~is%$bmu"0RtȯI0I" ]'R5fG;1g{JeBi o_/Gw-8u &%Gz$$J8^+Y7%Momh>ocQCwI@'A-{DSՖ9Vʽtg<*Úym .̤ :ECæI{u) UdAZ!ֽ @xcd 2D_γLrm{WW6+]P+U2S-$OI& \g}_[$aZbjGdJcZ/ʼ>T^|1;ztXCès"KʺEbEZ;v9ySn7W nνA{Z'I⿶fmjPg 5 M0&i˔RuDQsLyl hqM {J`_jWO vo ,Y-夑XdQN>IqJ{KUJ,ơJ\QR ⩕YSR̯e3ԏ6|hUa Ou¤f?_fL&QDٞ(E}Y wl'9[RAGC{b!3=*hhTԯ>1qȗV87{ POhPfhـz+v#cl_[m]RJ<;!,+*Nh=[9$9g51k1YDu˱*S!dlDF^~7p˹w|D4iQy^I%3g{oѓ("I%%1+ (RB"Ibkƶymd<1 #&$f%͔o+N7q\jv1lM%Y-D׌0&l$+JIǛ2w.Fk%siTHf/ ;#^Mq:eegЊATs,y*iq>E{c.NJ̭2o`+r=<)(#FGtsX)-4Rg=ˉVh^/qTV~,z9R0گW,v;UQ<=ւ8ƗIF/4qS1A8_O/!u, ^^2ͪ@LrRVĨkŶcOU)dc_9}8s@ =4EdzXkV%tt Hޣ_?Qx^DŽ3e֔Ď|8N]a_s oБ?6uZҿ"ġƥ[3ƳY#3X'9yj=r)Qʍ@; WwB [/NoJ G}8Eiɥ9zZq/@X p'{8͇/WEN|㴌yZ{FխA=yr)?bR~?ov=RS2e_"Q(S e"`$X|E'7^| 8e>G+Z^S˄EWƟ.Qa|À!pQr[%ڒ${{GӢ^lrr݃o ]Dj;-_$^u)j x&N˹hŐT2Gd4#Ȱ`J ypkWU屪>.T=lib;-sd5G;Zfa6rF\Y#y驧.v1fthLMM,X,I44mwٜYe=#D, 6Ű5l'm L6%,f ]eRLAϝl\j=9cپdaonS_thA' V".zt/6{H(Hڈ]ҤFy+9ώmW4JP;#Q5֑= H*h@ŷ.q;W{jjM iYћ&ٷ6Il:N~uj,z<~S AC:Ehlac /QQJu=="=DG;_6dY;V:(:00!c>Α;wuQ4zGTUQ*zuEb{'g6/{̳wrgK yCHNSd;Ҡ 5ʟ"1P{d[V(lS5MF2]E@";kS^)-ef^F_Ǖ+BOo5LU|xvfӸ>;ɵfp}iiis3.ȣ-8@ }!U7۳UcT^n jU[$l qI}7̨=GmlMϐCHB+p+` Å9x.dcMu( ic9nrnڽkaaI+5Ȧi乍-'"#UR$7zp 1j23^ΓGEZaQ;=oI] lðADzzEi8sLAMk87|ٍ4a HZy"bcmv|\op mX2Lz Ϸ79VU[(Ƕ&Mi!S#mWUkN9f`ksc6))r>܇|yEH"~0mj7 o+e/xmѡJHT?P!u1%5o2O%ڈ[IDeļ"'/#?,i2ڭ%ߐWvi3|״Nŵv*ål NFb+rM~'׆>{b.O>f}οPLHG'8*&eXF{6#AB`LY6͔!Hu݆C>BP(B@+l!"'$"\?uܒٜ$9#bO/BkOP ʕ xcSZIgehRdsNJyBklk5x@Gez5xfX9>V9rC0Q |.{ Kͧ1pnhW")w|H1I3@N}#IWwoFS[փBK _Ljҽ1@&Z9ʪ*"q#GJwEs KUcyDW1[O-C?YOb<@3f9Fi/D)~#zXxUr*9rsW$D{xֵsxWLZpHU Í=|b;|+JW甠dz7SqTU|HEVuZGqu"q9<t}=@53zΥ@3' "W ªxKmMTyj`Lhu6Lq EƸMck%Α"-Jc̊r—jmx $erW+tFrD3?m>w2lq0\cO$0[@}K98sȴ鰳S̬n>E^mo,˳(C2GǜЏA;r& cq!몤4HCS'Q_i퍭[{ne1XDMubƠ`zAϐ߻T`\.Z5me3ov*VX3<4_Xխ1cy{!\^N=]l MѮjY|zҐ+[Z>о{{t^-K[ Mj]G- pitgRy:AQ.wP8O S,Kvq1GނTg&/! 5#@ ElVJ!P˱[XT { lK6u*(@0c<luQ*250ȑv'F1} qtx(b:WUYJs"]% v\4HW*`7mݹmۗm)Ƥ;aUSMc9~\gsр llQzZLb5Ar#>|V|",3 m^]G׎|GWsi]l #OK&Q[,sZ:ЯiS֮̓WXE̲ Xp_Mc=ToRAk;b ^?Od>b;Ȥu D$M+~2lu`b8mUr5]uyGӥ5>Q:Wu/Sj5^W^cĮkZEpyj H AG?WHtz^eB Gǭ=%Ulə2UujUR_y y!ɊrcWFTdQ;Z=QUsEq cV44%V̚#ܩP4G" PҪz^ m%HQ_gSIW*8oH'/J+TFODjc5^"*j?/@uulwVȆ*(Ñb呆Q|kGx{lGʗk3`XL#kgD,Xp^A B {}4"9Uꊪ;caa`R=+K]Gn.,ZEa-eXRVeP^;j1vYJLsdPY6-H{ݶtq51Z_M"C>Pjȴ͋ fHDaxEqjZޮ<*m`۩RեޠX~jpo*A*?_><&),6=lݝd?A,s1k 41d;@ע;Ap[+VP(.lvؽʱҠtH,#ЫkZP7d{R{AG]fB?Ii14=c^T5R9sÍ5M&u73qh~cɋCgm\.%-JY+Y9V|f"+Ks zQBCG@jrM 84rm4҄^ӛW [WޞjYtj(kYU1y#pVVX;tߖ0Y>AH'ARHZ;$OT$ ^8U 0 T4D-%14χZL%fK{\L YEF6F($Ʈm1ce-(\\0#fr[u4JwA#ZUN"Ymf#n.gMFATY%HbII$,@ԪGܚپЦ !0,832axOpn_=b„,hG`WTR5Q^Kj8H˷Ʋ R s+dXu?w~b— <$ƥ9*,ۑOZ6E?*r?7:cazf39:EkLil)b[Z!W[.e+,dWcl:hlZj.W[ trYG 5U{NzL]MHK#!0f&ԎJWtƯZ$R"ֽicO̼عVR;p*܉10cuDb-Y& ɲ{yRKK9" Or)(ϒ -iHeRòʨo(>>E!U ˩Weҕ4fgWa JScsk ;<&G 4w#=dZMt˚!Jp\ޣ(ZjZO`]]cZ,\b7oZ\%xeQΑ"3˓}箤ݟ5!+K[?J0*>LdQ "'KNPy'{=׋Q% vElj%}c 5kJ 3,c2FW5+|(r,y<`Z(jtu @<χ7oer7w 䶝EAQN ɏ uFLT>!56CB7TEif}'eƭWS֒ɐ,!5l#N`gxCn/1Y63H_DKb}$9UMLÕO ~'>k qٝ};$b&D1K!X*撃JU:Av^ujMk_UkI+ LL"t5y2^؁ U =0dsU6$yJXX͌rVS#1шGBwv:]$M XdXVos=EEz[Y.fk;n4,,PE/A# jPϥylwԕxsk%"xM-N9d[,iœ"E<#d;swdZ(q!r G_X84V\DElPcFw4̵1@Ci@!4y- T|s@y1pDZ5%R=iƂDcr<3U 2CVA= {ёo3?j÷b*et!BBKnBo Eljs1%XoCxBs[QaD𭴖1p1X`֕W%'ெ5;[b{cJ4qh?-&\[L\]EמBW5bUcHh1C!Y&jE W)޼䍦Wa-in6OphH$>G8BevU҉L=o5 G%N, ٺ28EC4r"Z|ִZ\Y F㶼-Tz8ibn2V(ayB FG4r9 Jz|kφ'%̨iZtϧ|=|j8ৌxU(-~?^lg{z_0gG~ӫxOd֊?֢Tj;wW<kGI8 8g'K}>,Ҫ|J,Lt+]HxZ% u=yϱHI \R3ƸUpܼ*s¹S2ȯ&#P%ǯ;.D,$ȱ>,zÂ1xj1fUCaKm)c±KeȄBt`[ρqA^hӚ+18,AYx'童Qx^>>89o jIVR@:yOǧ`~u.-ec"YuʽxQaZGW7\4BHSl(FKG7֪UnA4@؏2yjcds.# Ɂ827@Hx?Ȯ_Mu^ⴻB#%& s[.{[۲㯥ÕvK@X $15)`:6;4^bs=WiEm@Zh@ Q\bXñ ?TP?5:;bp}{QmO_ĭb4.Ljm|=SXfJ `Χc,s=Y=I E6QFQ,|t P݉Ul1|=^[nű] u#ড়gUш"4)*AJBr {/ށtuPwf6?faX3"2NC! jRV㊹ xOeU]W6N-k HR8 Dc ` }<'M__R6sdmM=ٌG4vUd 9,OT}^T(1JtחpE!2o˪y_N 0uN(rCaY# r(.5 eĝNi3PΨP )CVFt| ZDp+$ ~=h ÕLj>L&Rl=?l@Tmy^|@ljܘ 5=#g[?&U&EeARU|ZIiT| ɳ&s:.v D% <ÜH+^KRiýq'_qE{\³$(9(BG(ھtq1b"1mԎDDr/>IUq'ű(z)\!$Fz׬\q됿24LG/Zu~x^s .բ"[ӗ*|O6A̵9pʺ-j[#pQWG Uc:CFh<(trѹxG9矂6.jk׈IvjH„UW><^Wp Ȫ1UTV$55Ţ2|zQcQ]5|m[op*83oʂ5㉲,6[)qnT&4 5/BcPqEskg-QC:C3\%"W1.hj8[FduJH1G}ydb bY0z1sʩ_0˷rq[Hu"`m}yҀˇk04XʨSmyӅ65:e URng6hC,Tx@Ht977݇i  im0'#*45xX AU{šM HoJpYM4ԉQjHr]-G 3$"=%$O.Cmؽ wumygi%ɇyq*2FL ֽhJG*'v~r\lmB^ -#L!nB#O>}!7'DGGpG"#k5 7`QnܗFY6'3GK;}o㴠tF{c"-# 0WriۻZ&ۼhtfUlfXUtlA6&s-lQbkG)_eYȱ_{VQ"iiqS__>qg? m m׫@/>/m}nissIQmb^ +(iK:ݘ]<)i:$rظMb"v_Ƚ$KTG;F"ʞznF5jk9_ n=+ɃVǙ[;`cxO b+UTENVJb9rEd=$؎>S}5ZjRsK]!Gu#+Z:׻w/WڋN6X`g=sҍOEbT-ܹMz"*r^5D]GV#㥃ЁNTнեRhXfRTs<9IlWd<Ƕk,ҾAVu}XYZ5ir]9k=g{s{WdSp{plEwY1pE4Yo<qE8qb+o1yCkyFk_c汌.с` ѝՔh.Ǘ';9|W3'u&w.ݮYaXGQ)bxzvԃ1M]##>|j}w6&:/#4ީ*"ayr**o riSTkV˟}47CEb]u5"):_NsZx^>>?{"l8Nf6kbQ=gYI,nXncH se͒j%($Q"Xh$¼Ybvm1ndjWzN|.gq[dHrl}-Q6#Xb Xΰ3,6JNb:ǜ\@6 -eO*1%Z9_,VbXzGkQe *H*.zC_P8yWuu<˟Ckonإv=*ymci.|:J]s1Ҥ6=/ F/%DsZzSbT>;v:VGάXΘ[ziJN?z/2>@]`7R uR}ڇA [2DdJc`,O#-f.AW[=UZnZd+tn2i8mdXS8&0ZzqQ\:.o%tȑ4+`:\z"9m!X6DMTJPyu$<+sJn,BLɭ;}s4(sD6:Ck]qfcEKzp1$ezUEˉXԁC_u+א)cYn׏c&?3AG*Y1xD,-CԆ8h0e[Q_}<mݔWr2F%z(3U/wWRqe&A צK' #B"y:/22)N4Gh&W >5&֜ ;)a:Virͬ(Z,Ֆr:ţE̥PH#+ֵm`}' #@eɩ[Zlm9i#$`r,@މU&{kԥ`hIz.ޕhZ,8qF4G9pi;L3,=sq>^8LX9lzʞvce*Ɏmi5[ag]!׮TkA(GoEux=)NR%X<h\=紪wSYem"M1QCSPsaZU@}¼1{c3BNȏJG#_N-386K^;೮kn̲ X47"S0Mt$$hO VWLQNu8fkX ~=z:K#SfĬpzVEHD "duFTŽqQECZMj9AP@2Zs=OÊʱ4|.aW2lݣXnJGULx1%TByg~I]0E=~=# )um2TnDsZ]ԬEm"g2=+O-*jP=!T WyZZzrԴ"& c2 jm(mr ln]] ;lb,9 VevO"L^QoL{,~-bsD\A/j5Nzcxb6ʹ0.+QlEH3Kޒr!UxXE~RƭWmuIe@!-wTUԞ+?/IX;k2 1XZנ./)ݘR~5ΎH-$ųK;A&1}F\$]h1אn:6FYY,I־k伧!ܓ>ϸ'pqqKYu5K\G9֪^,~SU k%WdiacU0 U§V{1okhp*񊗌O58X674m\̸>IJ9'NEFu{aW4窳I]GV K7F2JHaW|R*̦1$u GPJ(u 98#c;VҤB:z׋|¶UU;R뙚d븻\Q9Slp{8>=FIcMsVO9*E]2JE@G<0c[0b-]H#KBȋSDu4{rX $#<3H46aOv %~!hh[t3|27&qN׃1-7Wm;# q:ݍcL;~,ƍ&1㺬sd'[%-G[LLd &1dI{TL3sZ5(59ґ]MqUC!&!7Piρ&JĚV u$qTg)>m٩G[]Iky Ƴ>v]N93mEn/:4Q+A<5}fAG\ey!β֮Ala*+ZcAc嬎cШUF q5_uE:h-Fz #IIHh}SNJާ 4yOص15i={0LybA­5~ɉ*;2ξY',K_K$s}E'eWkK&ڲmJM"tM"_cQOY .'#;$da Saֺ{, ;/V:r; ٴMEcNu{?ֹKU뻬~IA[[KVgl$j),QI)2 6@E ָȜ;N|'؈.,,UrAPT s yVI!z' s$6 M@"y~+_o^y Ͱo Z LRԗ YTI$Wd!,B_[(yh7jD1bCD1JT 됃8gς!ښIN Ȫ&hy^~.7 dJ6\ZXFcDl :sLXĜds›j/^o`y9m.X8VuPc=b$QkYuv#N9 &:mF`v,U-.@f:^گ U*WwgIEG-SQ@4jxo,!fd๞%hܧ483+l]j57,n}tGt^تf9Gs&u%_ג!\)fՄ"D6t˸VrAse/vtOp}N?xͦnL2Sʽߟ-D U= SƗnՁG$TmU碲h˩ЎjG/"|\7?$Z 7>G<#E8mk;g ӣ^"/Ca9|O}`O1U*y/(tBFIi 0Ѯhzp*~φ8L TFSS˅9𺳷HP^`q'EG9*s#Q@$E:U"9|lMY*oHD5R96¹TN~ q2$9~꼵ĉeS,1Xb{bBv抋򿯄92iND^ -K$1j;>;rvAeؚM5IF좊 ^P5g-?mJ0х( NTU[> {bmQ: sǿRA⭪y)w̰Hdd) #4BKHYNQ ]eU@1DM2Auq2+DWãR4w͌f&IQ5Alon<9qMgonN˳ʽjyJ׆2A?fz_b0əKQuHgd5KĬf.aCmW4yVFR[Fg$0$ M c(E7>QGi欃n8K9xJu2:F~jA<[ƼFRF..HDž7W Wkb}iZZE UdEuY82{8!O> Y&QĮ4kg@mu/Ni3en(CXfMI 3:rl!do)xm.!9i% w-ܪhe42I4nb9-VcR鬁SÁ{*Jbj͇qE2>7mX[2vGwJlV\چe`_ΒGL; HBu}h䌄s9q2"b(h"'ZFpr$hQOK5m%'_S׆!>ָeMcXb!$B4l2 nFHNb~E^rqOǎ3 H~ t6f~aŸwŨ4oE ) BW$+\SU\/*9=l>GL#HKUs0B,tQ4~b#U-Qu5ru o~ QM]M6 BZIl`C,WH9Vx_A@SF.#nU5b5C; _p,,Qpԉ3Y " ܨ᪈ߗ>]ʻ_G*U?q4UdX2_Y9R{\+ޕOkGϒ. |+wcsc&- PX֖Pc>b;P)'#Q`:Hk:Y( +QS˥>x%wuhAWLۈRg!u|rM {*$**KuoGJWwJ R4rSs7SU_~s< B0l8z>R#r8cIc[>v1D׵ZA kQywTTEGSqƝ~8B ͔#zr O9 F͈M%"/SU8t^^U׌_[:51=4yXV)EB5'ǽl͍;*Qs2UX;4TIř?"}ĉvr^$[R(5=2#dkj滩8Gkqqv&:jH"1zJj E8 ^8Pҿq&?^UgTZu9l~mr1l~)g| YC|gKiPwI-֡AZUt3l Hr-.:]npH/'Q3ZCeeBJʨ*G/ji΄cVŘj E9s~{M[oLeo{mGp i26_l&ogDZ-cXt :x<#\C+X纃lY5+IVI Ti+UQN<+ݵh)d`$iƥIȇsU(z^ Te2ΤZsIrGks8%tM& OuC2,cSf]F` ؎Hl)niak&]+8i1>E]+!6EXTBi Cg:TxQڱip&F5NXu񾂠SԃBk>-ӯ-5c0WʘpUy-ﴣY7֙E0dSv{>։5vƍ_yQM{"zC&>_B bu)[`( 4u YCU*kF#Q*^ sn!uц*9 U$N J> }џw%ˬ؉ٹ5;oΥ񙹥N׳hw9+3{Wpn[ɭ5={Q0CJY5aH=#Xqq/5'MdQc:gk#YI3B5)`*"FuZ/ׯ9^ ]ݭFUVT瘧c>%IKa.\sW48mA(ЧQ_R} QdH |,# ]t)-X.U1(2*sAX[O%4.!B9 Ԍ}zW9WZDF \q8oGR*Ǐ/DELEe^*kCI%Ξr #yYJ*uFQ"g^(f4[Vid6pIw/UvcK"WOYB!8ϋ_? RXc1BN;c ȲX5: gR v+4V%$LwyK:Ige"y9_ШkʅjQ֍ǯ/n'f@U]qUƙVrb&gIf)(!Q;1'PdmSqMv+-!s[fΔ:J""XJ%yFR$(:Xz)cvVbMNՏkR* A6}ڦ3r"^oW >Mu>+)rE 7\̊,ڪ~0ZMC]qZzQ!^xW"\}sCX'ßwr`F:HcR~:P"4OG^ Nm啘ƶ1 ԺbsW=^eV[ "cddr9z]u@l92MƟ2'TaQ4E3r8_/۾ELrV2ؓ+?iS1mǤgc ׭Yt+U=<?&vDfU.;{r-ECi򖂎x":5ĪÃPg7(x|r5YG#Vu/?(/~{텲.jIdy-TI<}⪆3DD5-0[gKر\Tps%խN|\m&±FzfUSNfGoq&yts2 UrL%L"UΤmSm K|^bguhl鬓qcVN8_Qnkp$bYU S-nig D2<###S`zIi[XK)p I ]o騰4"O~ {G^tPY}Pa{"$ӛYL-y[z y6-gAT${֒fk,n)tqX9ٻ+IE$x"m Rə[Tfq-G2@lj :*NZ*Z; t8cq@IdH'qm*nTv=kc:qSAV'r״m^N07ݒTXjXg EWY :!&127!QJ(c·be}68|-IoٔU\Y:1g>!]MQ.lj옃|Y35YL,t2̫!Ȫ-mw`<1YՌ*GxUW9 o?Y\+%rlm-$ @?p'GueF)rA,/A^@&P8~AtH5O}5ܝIiueU:uܜ$vP3(qpcY@@fM1ueے$y0کT "G,KbF1͎ ъsp٬Ma՘H򢬄B (ǭI#.L/|y;o#!PHqSK " ) 7^A}k;9%n'mkhr~lqUAi)h⵮0>d; ;1GW5ɔ嶙lvu=LJ|3Vi+b=2zLg$SFgW>'gֻw3y&s5kkiVAFztIl{ 5~0>0ZFhIW.ð-Q>2D,'۫%$tDA^@*cpQ20 {G4MDj1oy/!P4keSUUxAcQ}JbPGd1{!FyOMODaB\$3͔lҖMsSz~YFAP fruR)QϷH$qA4gL¢F6K.KOClK"0eKV] ڳWfr gCeScq!KxX˼*mEr—)FϫٲeJB+T6@h_SC;DFɾjm{ь:o@+Ppľ:YQB9Ϩߥ>W^Zc3]cXѦc9hCVX%Xsq;Ku/ܚO.Z"-qcɿf;zY8v]2EV~y~N,+D@&z3ZB7G 1#O 4C?r(E+?ׯˋ%Ls+HC\p&$ TYT5Y+\BɎƑDwIA>^VDZ\`T"Q`ʐ_MYFE3Hʯ|s=r"p?FdH RtXq>IG䘐BZa}kӥQWt kϯO<Ԟ\2݅Mbp-*j5/&رqO pC]Xo繊鑅%bĤТQGp넵et $i.IQOy:6Uxꧨ2Wt*NF*yE~/C^>8\C&X)[Ft0^@U.TK8p='+ӃkQ^ޕUsyj=Q\y;O>xljWȄk}3zCccaqHnt'1x^_Ls~TE'ױqGb(DN9|}ϯzcJz#"i\V xjzb3]J{ʣys&%HNcAxD&>.MZX cjsUʢ9,AonGFPH4YZ"J"՘>#+˗226Sw&Mqx;fV\ӱb4qkע+:$S01ß6:1Tl Ki F92Z{c?8UoHP19UjGd'5zOJTҀ)J#}O^=HZs'-ַU/ =HY17tՒù9dՒ0t!2(LHK̉%03z=F*/>415JY+B唖TD?.#mmIVena}+Pu _Ӑ5[cU"^_̨4 ծ O.) =&Q֭F|9e6tjzl9omfO+1V^@-:g%ls@F3zъTҦ%`RGe @YAjz0{ƢN9@PSԯ:҄p:kps{}'V]n}uV.8Sw9]['#WOW] ȥc7ڇXkA`]>wLS$d9NQِ&bPQpӣ#]imzIAFVUo#d2"SI" 35LKb%{bE4F#'$(1ֆ9>ϟ7DYmێ-ig+_Oȩߎu+0|/\[cRJ&$V1zw КYUQ2Y2;.$W0$nBҹW‡!p⦗n[[(fc>cC]1hJơgD@>mOQHNM]bc7֞A\eK1FQփ\]܋>![ć H!b8xQc~5_yG"Ue6]Et<Xo2 ll b8 }G&{c$-,I&΂COsShď1Ƣ:Z~@99ׅ;o: :+s-ɝ`=y]fY|w)z 6}9.,Lȇ&k:PO&]!lfQGOM5} ×g $+;Zt\5VB{+HP(Te}֊*7qUWS)ΕG. r[rkј=?v3w(͘N1b; 䄥HBGv,0Xf1 .l9waY¿[,'ڱ\eNSmouaoUV$j='X\HJGl*+@A$>AR8=028bhΟwe6KNs||RwqRNJvgHQ;YAW.YN3I1rqX%_j+ɘf3sZ}iqusauh#Xʺ%nYj @}5U` .T|>/ҌoJ~V&8m~˶~͇cklCq{{[]AUid m:2 DBFb]7x, c_~g:vX(rf^תFy6DE{%\F*.֟,W,-H1#QS 4X'}WX|u24#t\GRoYk?]3Rj1ݗޏ2|'thښ8.idSWÎivtFM SqVT9[rJIIU؊pb)?Hm! Sm0ZcÃ8 i._s7 $s_ng.A7+MS I¢Xҏr[idVYh6 ,GhPSڵPh@jxly~!0lgH%~ݮoUf-ȴ.KŲޛI3i'5i`ÕDS.":d]j-(HT7=Ui8MD*q楬PZM mNiSH-=Dy(yOh)Jzqtj]Sܓ+Efr ]GioKd9tVDm"'>ͬ jj`[G.Վr962^MUW\$IҪ&H֣F(mkƱczUW"* 3!$PTןHkEΪ+uHV+J5(ƧG[| fmy*w5(vٳAdS#s~ZPWIjJ(;X\-6Ym[]䒦I!@6 *+ZBled.bҝ}GibHI&֔) :,Ѻnes;e'k.dP,{vc5~Q{Ԋ} ;[2XhcC2%A^+&xV3XF@ 8j#ڪ `Iv;Lxe"`C5$ pXU0aP<R`tPuz.-ðqָ#q6E oϴ\'7ZLx{URoqoO*FKG1J?R1cؕ,l%RA 5_Tϓd5ﮡ|dXKI"׫h,.`XDkNҼ^@pI{s0 т *] $'9ot*T7>:Y{m]%܍A,6;.;.֗o![Ghr7, Q1z`DJ˜,'-i޶pF]ifYImt`Jk5^A +e;+ޠRh2* jhӡ uv╢VG;I(!J׵ F@~ڶqK+6g0,91kyǺqc%$l=̀nM7ܢ%hgm#5]_0;,NnU0|lAoL *);8x'~WGg8X'=א>M^'E'pr-DF$qK ,y GiczJ;鈭@K'6w¸Z9{RhV2 GuV;"4Gs}&2= {՛#~})Ww.7i6R\!% ,S$竑G_w /3Wg,vu#Ɋᴍcb2pG+x_L{e'FǯKQ*|V9ϞW Bڿڔj aao{\778c5>+#]gRW :Tr)cr?1 p883=1n{B=jD5znOkq⳻e ~=E$;&lKqc{6SVyl;&ܺK.de2r- + ,0OoBS=ԫ^~ȟ3ŔömMw\i+[\v^9}u+Pr\#NhL.6_k"H)Mf@ Z`'4TN*B%#/Lƒ@tnK j6554FtʴOg{mS~:v->>˳zsw/Ӡ@ = 1| hp:O1gכ gT|IL<0+j6xŬhG%+t]Vqd5 H"z2LkpΛXG-uCVSGV*WZjӔ,: (L!XЭ*gǴv{t^Âq?v`.2ˣ;wfib!I^pc $eظH` [AŶ .SjΤN,:}]ںfGa,.sȍ_`=B[d mk s# !F'SoPS<$,e.~MNQ{k+}r1*Б.`4AZZg]h*|ag۴nf LR8Öfx TU_{s; }\ޔrVs{S023\S8Y!Y5!q3chp1ɶf׀Y i@8|fW9SX~+N[-ufK|t2NbǺC$9ڙӓ;չ՛6eM*cx˵A//TJM "C`k}qٛKj-\=OAH_f94H ơ;et ,*N)%%td/%_Q &`㼟 9DFPR>-^2stoEdd ci1VAcYVn #ǫ _$,Cg5Y>Y;ghieye d(Agҋ|8\ KiU14ZPQKԣ6 +m'[MpM5*@0e:8ȔD ep/dcў\F,E)|i97T[=eL']mLQL.kV➦2u_5kUw >Pl˼2w&l4M(44!GS+~cb;K<8{R #Hø@^ښŻjw|*RcZcrw_FƏ̀hO:qcAhiޢu}]wnO1M'="HՓ \ \ݱ#粙ZS"\-6 qTP&i3IڢGRw*(@{q~KPy𐧊h"+IVWd+#< iۻ^Be $ c# F}N9 y`½bhv+WKTz;)~ds"s[DOy"_jg !Rq׆3bWKQ&BC\+H2 ʱ(.c3J=5o 4(*GҁWXTc]tp*5/"9~#8FK+mdGs  ?ӎ) Ee;9NEƈz8z#+‚kƝUk> U/>ǟ1 тlrtSӂU,BCI&zsc:.+,^{үU sz^%_I7r&"$O+oޜKI 1F;f dwe#j~>c9:؋ZFrJ5漯yxόV,Us8匨FV;XDb#'Rsiy n`"+{Ȣ"pG呞S+ߏHʊh# 3 L8r.FSb"ҩг{߰7[>^_#^O^-Cן{A_ֽ8{sc]={ߗ*SqXzm/ߝkcs[Oz?v/ӽO>?ӧ=?7N)7']>c]+'Ν}9^+/γe#V~pu}#G:O3}}_^w?_}i׷}߫~O;_C |^]W;zSG>V׫OOvҔ9ׁe3OusOP?>/2oOG>?G=uϩ]T|hۻߧWrj3^cmek]ʝt?r=iŐhk|Gh ~7Guoܿts{/{[k|?P* g==>~ |?=ݦ)wMtS|?|NiNzWҴN?kmYnHWO?}йYOSeǟYgԟq};>POsz>g:|-1~#OsoW:[M5V|^NZ_NZuS*ּ}K}lR#Soro~}o~Ouщﳯm9.=O{O>~~tk_ҺFJFe4-$Z4wzMzִ^=*3o_ 콿p7Fo=>{OixjkA?>Uu!{/{zޟ?^_s3Qf9MZtZzRzO|nA]4?_N{}z9OZ?eS_u[_}zuWw??\>oz|WHSRˣshtӿ)Jו+¹Bǧw?ܗ_U=w=Oy\/s+v]w$?WM?ec^xo7ٯu;zMZteq>_׽ҼOӗQw}3?}?|}7"}߮}+>Ŀ^^~][t?P꿕GNO^TJ姯>99WZZ܏#bqazgokw?Wx>~U7o s~\1o5ޝ}^Z5ѧ5j7˫;z=ZҜ_#pV}߶rewW??wO?s?aFGGe}o￵퇻e/CWO竏>|6_'zZ7o]yuMӎ\NvJ8g:ϵq(}/g??OygGٷK}7_GO߻xm>gZ9WV4^hmu)ҵ뫝iN\22+o+keG.~:~O[oaqazOG.o۟?o]=ߛ^i4^x{2ۿ>>[tWTo>=ǥ^}c\2_̟nLYƿ}z/'/}/m>ׯO O_\?5;?>cku~i׷;i=W>Oʟ߼[!w}GXwf{l/???~8O_Zoڻ}5w4%)ZE;>CO>m5)ӧzzӎ}쾳} sO=/u? ^o&ݜ{JOc}>L/O?s%CA%^u^iοjOk?(t5׿M^ҿLJ㳯/⿶[wo{O叺}?}=__P~BubEo>oW:OGO]?Խ5:WU~kNtΕ[ܾb>F_O.WN|t[71W߿g2KSMYq3^},2??P^|>03_kHhAZiѫˍ;z󩪟ӟƺ}+ﯥkec_?޷/}qo} pnXZG/W/?C_KUbo5{7^םik7S|ƺs_W*ҾB;.El}~`S̿_FO{{<}qdua^O_C>k?7.8l>cq_/7kWjܯ^ZzpcO~r?̽~?}N|0Oҽ?1Jﵿ~οOvo{]6t]>N~?S̠JNxE;>?oW3ݟ?~[Z>|OqzRLsszt_~8?pG__ /)ڗkώ~iz{iާC4ZSҚxosIkۇ'h_}}dzb/o_uxl?0mzٝ~ۯw_x3SZv>W&Ps>5{x/j%uߦoot$8bCGtu{ﶲ77r?Lϻ??ɽ+?TW9w}ﺽz>{_i/f|uv_gǎuov5KJWݧU?*N>?Mop=73 K-tz޿oozuzdžcyi1irZs^߳kLt{|kiW۫_OmxKyc*p_W_⯨}?]??Ѻm]oO8Z3SW-#O~>9}d@|i}ΞO._DyMN};wGϏ>=_M=?zz81Ԝ7?:yˣ>_Ơ>|m}>C:~z}Gs~G/ϟW|`|_5'׌v'W>8s8>?V^㟡|:׫O^Jr5}ڝ\^z~K؟R}ԟN?l}Wz^GWx_`SïOjzӯkˋ?U>o}_Sv9iy׎;6DJ3˾=o?߾SO=x7oӺه>z_E}_߭2~Mi{=uOG=:}i³;ޥ|i.Ϥi]t{uּqk?}jL@s^?}ﶿmqֽ{>ҿ>߸}_og־?X<)Scku]wέ><&~NJߑksVZ=}| g_a}g޿s}wپͿ_p}߽=v7g};O}#_}aᄉKOOo_?J]JWvGFiO-y?+-}?%>:}_m>;^}OFfxSkGs}[~~>y_?d>bW_ou_[/kgu{+N|Vh_;{=on?}H{}?=o~׿ROOCǡg?Wҟo5~m_xtp:;3M=SEy)qdS0sV?{zWw8o}Q￱؟˟_rV}7_?oK\x[51}__}oѾEϺ~yuO_I_&?i_kNZ5ֿݫr_>o5jOowWiJpb#eʿ ?JQ{_]_{Aտӿ>ϱ~ѾP~ӧ/5GW?m;ߘ}4J߫ҿ~_/{٧]5qO/k_t?/?Cg_{=}_yqX){oG+оp{_N}__?g~=]?پ{ ~@&W6GݸzSZҿŸuxoO;?_})a_K+//>Kiϰco}>2}Ǯ?<7O}.>?/GܿzSu?7a$=ϯ/WqMxbg ?/]ë==~_qe|ޟ}.}N~n>\ >^_8<}\ϥޗ_^_7/}/GOGW>||/_7a1tU=տ?zy?N?3^::|<Ϟ~Oz endstream endobj 23 0 obj <> stream xPV_ "%*(R Hww<%%"vww+vߙ;syיYs{^j: 4TS NڟY5C5K5ڪqqi-+Ծ^v7 ψ?vje/c"5W>??3f "?ڊA;R[k?vWij;NfשBma {=|6oۗ}nn?.\Y).,W7ͫߜ/u޼"wZrJx6/88"dpնFN?@M?O_qZ uԷ=:OXV+֦jEyAݎejS?<߁pmEJzFn-ͫt4tX}KA!}-ʨa]qAH,X|pkvKxsD렭;llln .ǶvI;wzymY)M{| b/(>&::&>E7Ŵ O&':pݤ>&I9l%%3/+(;"'67)/=?X(x EekUwPdѺS4>|@̠0wn>d2 P 8IB6ФY-71g7Wɧ D%R+`ST6O.j[پý3+;tp𞑴Q}\6;93uȣϳ6λ ]H=V=.Z?xg4ϚxEK/_ym7vq]{>'fO}‹֗Wc޸5~#>}Eg_c+H+շ8٣E.__Iwէ)k w5]޺iYzO-f67otҷz^k^vvn;0p:]Jƺyoޱz7'v{ z7}~5$Gtk!(D7T#o|uc1 3qS ccN%KMM;~&r'9V.WrP!ZY\]1P$Z `+ֈ`d>\~[\rDFgO9; *>C/$"Y/IM*זVl`N.ARAh񗓺SGbkgs/-+[?թggϽCWWǮ]|sխͷwwG'YOÞ9=_Ë/^_W}Nݓc?9|V|Wַa?گߔ?Cm_YQvcr]ZZErusIzI[?]1,\gdhlݤ1$LyzE _6$ lݖc֢U6V.l#98wru^%~7;fGGg]^ۼw}˻O +CCpgie_?Z+_̏Oq_&k<|B.%ޥ{ˢS*+kym_|g?k@`?H< 7]._JIW?Vz1asy |@)<_XJ#drYIŗf+UhKY+mq.\o߭0~dx=eS#f-G[./wYJ99sg 9sQqkW^Sn~[o)[sr_ JI__^1_S5,pcԧ=]ljM۷o~<ߏlEJ/54=4hjcVE\г{?dZPZQ:uc&f̛חZxZްFVXYʲIlwԞ-QӸ3åx{;{wnw.O.?#׻ {> /D9k?'D1õcqĴݒ6ZuK˩2천优Ђ݅EśKJ 4~xZyB;D]kH P5͆ei t[1QA /PSXv m- WA\)F"?\l k)/?:uЛL =i4p,<14yYkQ,H8;u̖zs v nܿe=q_?}B~z ˻0߾[yS[_)hg_ƿ~:b̭sGڏ-OGC\6,.@z?AH7/!~.>O-z/GF`pgR8 wjh1XJx,ZhAs~7؋O]7Ϡ1WD fB`" 2NX ,ahYc'2o&Tk| u6c32\nyt8Lls 'd|%Cli>~Iol+$APB0B52k8@5orڠP{h+z*4D ,8E϶׏HTM!M#Hd> }uuӓuc׷BF)O@Գ{{aN:.&oH!2r*D  ~-i] lk ˌv:DZZxXzl .,hfHzX757u6N<X#A7fkW3^.{ mQ^tIM퇞9C ?<h/6|Edњ(20wGe",[aOn;`f0a_簾!tfzɬg8ݬ,>L$ ؆\@{Gvo-0{ncE^+\ͪhZb Xx!1kJxCnB~,]!93=ȠU?>4Q~Vr8G'}6cKv Tޓ(|E[dTt)ݨIDt4/k u.oYiQ6IU­DaWyBw9 ;bdf0zۆV Wڷ`mVÎȚau"MR(~Q3*jGsS%N~g5gj\ 7/ N]S3BanF-F"9}) l >(KZSrye66qnjt:qz_r"]wt$]tsG`LP+/8N-riF]X@coM K#;cJ nT{\ ݇y"T+Ƹܓlve+NdT]aB[o:vaz =ŗuEl7Ob61D| ]$Ev RL?zDf:0Z(F7JH{_ yƧUpǣx܇##\.}}sMP ^$չi,xjf}HugB3U h',u:|CK6BԵnpsǽHܹ1/v1 ܯ0n5%켜')c dmLk_t8`%;`\>Bzt;G#`R5C6u6+=M+!gi^"MA!ćI%fxM-QkQ4?1֓B)QjTȅS#Q v:vuIcD2HfI"HO) 29 )@qlnK{< +plb֎1/ 3יgz<!N*J"fܸ@ꣴÉ9䄄+$ oD\P;;w%kF8ShhB4Y1nPXjyDcN7ǡ^`Ƀk0 ҳHVX3Fpssg-)BLi7DN$"WE܌j}p:[k`LIزӿu]XG[v4Ǚb:$Or {Zpy{NcG8[j1-|#'t*ܩ'r'=rȿ:b HmDM%'?-[#=db{0\7%(syӸ}HokyE>7ߓWs>WV4])p@_wա<)lQcEp J⸒{&HFտMYroaS쯖dSKhp܈\P7W׌nkR S'<؇ɬ3HDu!w|!^&{S;o~,0R!)Ac$oLk`7ؒ^C1l6D֛i˦+-ӻS(R 9=!8,B(u0zRXqς"y1 Tc̯\!6Q' K^vta3wT X1xϪ 3G;E!c֑^c簛l <ƴ-3UCV\i3c&<2fj}zYA=M*C) Hє,Ha*-6Pܤ^Rh宫.~oq4TǪ+ҙ~ rHVVa_"Ai$j i֮bB676t4M]m8~+0-AQ#əG[@(сjK v}'*] &rO[o\`aF1#rי=Qds%b> U}ŧ2k8~{Wv-n0F6 QLY؀\,W?JB )}Lw( mKˆS#^MUQ:1KuH!ix2d)GƖsRl_da{^"Q{PIz4vԓmu&6Ip_I"|e㓀Q\WVVeυ5vLjP8/=WE[ tqDX 喣& 1=<<[Bw^Mm LW> Il! v"e&X17ߚ5͹JKPAm:Ud-"f޸A;h1 B1ZAJKpJVq/1 J<,@=;ػ`J+x- gZd̶#2в iP ժwˬsDF 'H&$di t#۽ PUn:ʒptl{&6*h=s/bjXN3]2#eLJڄ=T )XZ'Lޗ+B]%s=FLa~(;7mkynf?PY)g02R;Zєjy{Cw""OI69UyGD/K2/W/HFF)}%.>Djvۼ[KTHJbpaxP-. ır.;0αwg[6R26n#ivfhݵXF5-K5?xJeˬHA':eYJMe~EL!dv^ rEmh 3V%݊yCL5z@:tk}cDy^JX"T;fx+ZM&嚑m%ojop- keΩ׋'4tz,aGp?#%!>jNZ_,kqr e4WN^#=\i>`?ЫƊs m& -d4 'J %o ;g+AX,D*~!X/" 1S)S ]"1iJE܋&G~$LD:e![̡aDt3,5?]R܃m8Dlk6< $j 0oǹ3u?oVu1bauSZAUz,(ܫL{"Dݖ:g(w;;Zu^ 3zsn;WuY1Lޒ<,%D֋7R7P,C8b2 B^JR~E k-OyJ NWl/"s_߃~y GmyãHq`Iі4hOͣ!SbHoaE~$?q6!*Ĵ;,/Aq7w{/nŷfkų<"V%"٧/)e[ٛ( ㎮y :bRfzn~ut=Rj7=XHJ(X!X+qu9Z,?]07, 3wlPEV-rs͛f;gNKnF v6mp:(:oc#} y(CgRrY%ȡ4KD=»/{|N,]ɼ2}K&q3&a-]_(k,!1&L1amN8xPj` r#/Njw( [؋Cev"7&\oFuP !^?אp(9A Z5N4yK/Vp{.B3S -fؚSP~+6gzs^DA8O>0kelgi~DBJj^ a̾MF2Kh1cMzx.ػ%}tVc)q4DO6m ё?{J(axngCjs-)o4KinJ~`ȁ ۛ Ti/Z_KY)a ϴ3f_w`_0&nh^NNb.VPZt+9-ViekvUμxRGb3NA7#Zt:*δ,J۞߅ݲ{3 a5K܂ kL3@=Cyd>;|wyY+rI E6-5d2tJA RRd3HL"2O12e#?vOmںQ~`$Dj|ᴡ?ߍ"@UO 7GM#ȮJ;(-w[ ۪%{2Zjzbbl%aSU1|Ta2q(39]jpx=cQf4z$9h2XcCt$gffRxœr4a)uȴ=3rӜvϟ,bqCi_oC[|fUBwAwNi*}z&Ȗ eGSz z?vզ8zWuwwCw.Jj )vl{/ l>6c֑iMeQaVVb[@f>ي VRH1[G1\0*[Qt @p O}3>n<x#ڗ." : U8oѭw#گ s$Uu/**V{,\> >v2nt*WSI}s :]x#\:ui1¼;+4_-Bj*Jךni1Q* {Du)aA>xvrk3wOL!vsЋދ0*>?ӖM!F5^RE[rˬ#9$|c544k kqZ~d,0~w51VAz&:ylL`I1>/~<^R^+ x=h Q9V+~;Uïiǚz2[Bt JTFC۰Qal5VKNFkiSH)*}obۻƆGW h .lyls?wrQzK,J9Oֆ u}Zh9DdrׅڑyfQoc1ѡ'A^][{=nU9Q,Jt%8B$%[ӐfPӗvc;8% z6CBM0(+k{a'[`0 mhvHzMS;u%kԄFJP.; xhzy&1 {80t  dD[GYdU@"PKydvSNFE` ܢ☕h<]B>+S23 f}mz8HY5dۍ>ك@{ty EP| @3; [F?ݡ YO5;^Iۮ UzcrE%@T'aytX.an42Owy "HTǁҮa6!3:(9m2qd,5k`7#04u^Z~V} 7} `4dI+x9pi{ó;3AQÝcgykݒv`R[a9h,0Vj7]I0xrzs񶎲Fޜ) b( *u{kaB eHM8p=cݓu M^0n_=Ƣ2Cy2 sS834 tbݘq%eƆhƕ` 2A/,rb^I," W05+HXJT%6B.w"m $Ӂ8dVHrBĆEH-dI,"9X q&t}Ax%t:Z@ ^e>aml{?m+~ 0у1zrΥGؙSyp= Csh:ȧmB7ܙ9Ux6_=/WWJL'Fa0)orRQ fO,CH>JvLFzd|Px~+Fubo 3`V+`e`\T ظfF0 -%e y C.t7[PVeIKCzIgWP)$eͭSVPhH4{Q9dAڽP%P94C,րf V@=&@*&zlMh,vj>YA,G})0v_q+UKRRWH]Bvi4ȇ Λ.>rhG2tO34N; wE?!CZZ5!KNc ^B+nUT6 ;-@PP@*f@ icW i$HV,Hߢ,i7[`Vz O6}"<g@ }M#P 2qBOo `oxwLWHÈl//#J@E 2ECvHTfZcxC*A[17pu>;NEt/6`1:smoi˜sWYO*qILSX B69F@`P@5h ٱpKuRPANȷx;#$tS-cDž}1+;06Nr QIv&qeA5 Fq)j=+ opZ4gSŞ6LL,>n_К T5%j{(#R#Q")Q9B(<߀=һa#BCw"skޡ8rM(u\{$O MB γT#^;3CENc"uPބY;NQU vo&-C_PΞbb~]~;}lk%ԃt^lk,RXم߷7A$\ʣ:seP6y +&sO)`KaRI | 6{ o ⦡5$6w<}r-}ż%1˸5Ż4=.VfnZ+,U=C1aI>_ښG(cCf]9k7&!ky$x_"s. `DTT9jVh0|MOD*m3MM"kv H-ߺ> Gc;h6 GΑ2T 2ϵA2ZGBnӃY͡gqrQ1,Pe"x-mH[ƹ#~}əc y* e7xZgҔkFa;|D2)a‹:A?wY㤉X`6 =+kvV>QlAw@u(Tv:Hn8@>0 .֏xr {c5=nHoKA/`]I- hY0y̋~ҩ ,+X ˆ[ _i)A]8yW.'n="Cߔt8bsK;A)c&c:_G^>BB7{KCz$flJsChI!mkM-KntNG]jNu%|N%kޙ81S\~9ab+ϖ`>b'ddzhQtN%EI3Ji"R$Ry+Joƶ#l&1"MI:O^&S\^ɗH {#= _z?,F3m魯>*~sb%~] XM/J / H~ܓ5yv>ٰgBh`!F̸^}S-ì]oy..]ьIL*%>Þr;qoE[5BVA6k6[Ee5c,r@Hi'u;a1C tg")Y_ĺphos_q,Wp#J(ͽIO;IĘS W\TϺse@EU\=Oj<6Ȏ`fB'uaD.L<ݳ)a m( U}}`C-81(8 ;4)d%E2/Rh6