%PDF-1.7 % 13 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190626170359-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 14 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 6 0 R ] /PZ 1 >> endobj 14 0 obj <> stream x\r۶}W`tFfx=m4͙93M ѐRɟ7b˙$Nrb'4#J\{}}/|"[_o_~~ŏsQ@ S/|1NnW&^IxyL~'߁i }/g[|ۙ}fyrM#c>ơE'$/S\`Ny-$[GH'ł)RJF5pJȒKV"_~+A-*&Vr6@>7ȹ*E%baW1'W~~U.Ңc\$/8<9__u$X&eJ3ce5!';J"/}0~w^dA8?OsHC,?RQQAwh72q9s+DxA<́i s$%z+JhaaF[']$K5 %mɂqi)eDsd[;(MӼSy(+֒,%ݢŊm JdJVlP 9~lW3ɩ=2ԼU~4#T*B-d5 /PYCl0.уL@#9& b)onEeGh$K-z(u35R5z@9ci֒-  ^>XZl L*Æy%nA-w1ဪIf dXge_^2\]Jp 靁x ]H^|7#?5ځ\?zcqݡdž1$KA F%$Жֻ{}75,v!lf$ߩC݉"NrL <D7.PS:h.E2c+"{{wXĄXKU&RQz"ayi*001!U69c-lqDT%!t/D>bCEFHf';TzN&fTqآ´!4 rieejSc BAITZf&^KO])S2 *Y&ҝ|`-&` `) V-cKqD+[e,p`Rm\w@+ u_sK9ܷحJy-F! -5q8:o\0\f9؛%u[ÏS؜<<9 !4J|br };xB=?b dJRʫ}VL NxC,|@Hm{i3o'ްZt@4LW}. bx}:w0} _`e>2LC >6%睽n\ ~`J=0b= s/Ose͖5`g3^F痩EphUbcc6Bn&a2"=NRvD LfF^`~j(lpU]Vzy:pCcXW87el8$si C&7'C@[W8gz= D' ۍ7NsQD (ϷƆ2*+JR|a-+EtJ}.j&2p@3]U6N JB洞m!57mJe&35 "pц.R=3#lgӕ QbH%XIq~ْag2dgcG32ՇwՇJ&򆒦M.IWFJdQh13vĸ͖Fov*By s 눎땩oSyh7Ђ"H طl;醺`afk?: B;W6^4 K-qdF3 % Fc.%5 ky3R1&Cf{Xla g-( #Xu޷3˥&11ѷȠ,^3OC 9x7ԐmG]ZtMDyIV}5A[̱FE?%lU8$W$'/wM :ݒ.9GaZx&&rQх:2w 0:fB ^?zrϡZ٘'ηƃ4j!0Lq, 9~s L rBG9,3lJ#DhR8HC$$5yqϾϠ'X4E Ϳ+ Ixd/9A endstream endobj 15 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190626170359-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 16 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 8 0 R 9 0 R 10 0 R 11 0 R 12 0 R ] /PZ 1 >> endobj 16 0 obj <> stream x[r6}Wt%qdޔ:+WRQvUTyD$AL??shtem.$A}N7`J+??Pa'N >1? N_f#z+ffw~:}+K%qfP6G?^p.~?tqHH($4 ! ( 4(L„$i(ax.5$~FYH4 ~lQp0 }Z5ș4V\W?ƅKcXxشF :%*3^-[֖tKaaQ"A`S%kL fRAFLfy[-Hu]-Jf)LJs7"Ҟq*X$ YAQ%W'k].DE۵1#,BkbފZW`d}a%5@{COC.p-R ]texV 'lC6Q >V5nmkYܙ5m%b#55sřqarSԇ|o0v;`MѴE._-9Or!Oy) b^5#&SA!yqh V*Kىt]S#F%qۗOJ?av0}-)0ߺ<]Fv \iнB(r(9@a%La3L$v{ N ^2zx c/6Al &t`pJicp/{󇢚r"tFy:rZ( kdBd rN]_/_.PuudC/4Ah\4 k{^ù88SX?+K׼38 )m1SV^LQgͦZSH [M?GmgQQμn9SUfŰBc@[IF 4wg? WÂQ0(,%+H_⩧.vYƩ1H.Sd66Yos0Gm[LwCO;@; 7 Y"Ԕo ]?%k  c <Ŷ $,Oo'rfe 3zQ't`ھ&.Z-7TΕX]E_;^u*mjK6.ϓSQNJ]ы~6ǃFvs?C&QzOn͒3 +\@7D4~a->hP[bqr*PcL#! t`vE?D!}iBILٌzz $UN _BA( HC(ݢVWO--8&apAVqeXA=YD"Lع*fR J¤ qCi-G^!!3,].FoA(=7:a(=q/y!D!_r944H)}Ødσ4HJ&oMS$"Qnf vmdE F҄+?eqZTr)*O\g6.F޸+BJ 9naz.ϠƫKK/m+lfsհː ^߽B'?Klc)aI67}!>'/&P/W:$j~>3; 1afcRMiRcf^Lq=Џ{m`#J0J}[c~j~[+1_gvo7jڼB(8]={IBsnߵkkOlS9v١ZɱAթcXb.{%[jvr- mxˍ75ȶ^o7Vb?|tX> endobj 3 0 obj <> endobj 5 0 obj <> endobj 7 0 obj <> endobj 17 0 obj <> stream JFIF,,ExifMM*nv(1~QQ.#Q.#Paint.NET v3.5.11Photoshop ICC profile XICC_PROFILE HLinomntrRGB XYZ  1acspMSFTIEC sRGB-HP cprtP3desclwtptbkptrXYZgXYZ,bXYZ@dmndTpdmddvuedLview$lumimeas $tech0 rTRC< gTRC< bTRC< textCopyright (c) 1998 Hewlett-Packard CompanydescsRGB IEC61966-2.1sRGB IEC61966-2.1XYZ QXYZ XYZ o8XYZ bXYZ $descIEC http://www.iec.chIEC http://www.iec.chdesc.IEC 61966-2.1 Default RGB colour space - sRGB.IEC 61966-2.1 Default RGB colour space - sRGBdesc,Reference Viewing Condition in IEC61966-2.1,Reference Viewing Condition in IEC61966-2.1view_. \XYZ L VPWmeassig CRT curv #(-27;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)KmCCj(" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((p <'IyPHM=xGYvE׾0O֠tmhkEW2ZF1VU{V8t|Z5/3^ԖVZl)ȮǪ^jnӓwְ~bh{Kj|5Q\EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPQ\\AiWSEmmm$0[ 4M42QFI#*"+30PMK_ 7zw/|&5%MO㏌tqb{.mkdK7 kwGXL3TӊMн-U*JIiN*Cl>Qxԩ7ɇ_[::j JR%qPtߍa<gE|D2K㿌ƣwΟ 4kk=6 gi9-eӬGmt_AsS֡l R(l>uafaLƄӿ5,f" >ZI=wMhFr쾼\+`p jϵ %1׿KQ222ů跚}]tohV7")Q4' #G^<_<+}/Y؇f?I/a+; mJ$6Xcx7M3^A~??jo6ÿ<-p&{H{R{4^Iռ- 7<1"cvnY-O)hlmI=UN0f1KxbFz?u~S:ξ 7N/zZ䎲*2:GB]X  AqNk?~?H<o_~fG~Zg-ÝZ}Yv,zl]sw?_~o;,s$v\^J^ZpVѵ;kMWJk-F"_71ʥ1Xj2pF*yF:[Iԡ:mUa1)PJx\e8Ui˖*GaܴUiڅXөx/L+;Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((-g}1~Mڳh6ռ^ZNa<7k[hZ a"6/N.tB+~m-+Ǻ)~&\%>e54ovVZߌ,*>>[Wп7^C01RUeO+j^8$^DK4vе~ !ŨUN`¿m/JC]kƩiT xuVP^1iUm5<%E*+HU&-|:qE +S+',6.A8uԪPBUhTV1inhU.z5Tɦ^%*u`:π~_ / |7;;g|G_i}^wt)|; ߇[[N4/scqiwqu>|Mֿkk@յpML~:Di/xt+y?78osFm{Cu]YuKK[;#fc^ x*Qԫa+4)$*ҋ#Nࣞ*Ҝ|6񧇒h;ˑR;qkMúu#Lд4z=Z8YYE00D=+NcORy}Iy&(wv1x,!E+c$#O//ھ8? t({^~/2L^o>oU32Oُ _h?QI[~К%_#bҠu<3\i>3V.C~ΟdO{'h_ .Mnmc4]SleJмTmc7+ Wӯ"Vut cW*7,olNY>Tk*܎3 B=a̻GO YqE+V0# 8 AK_?d~z>|LOZhė/'H$aⶹ4"jԾH-Ϭx7,@m/-5 h,.m'+iYS:@ee<+УF6&8,|V/|gQj2 ͬ6F|̑]S,'$y|\6YqŎ ӵvqUVcLhKkB~-\u`xV?9J+$4^I{jq5\-{٤/-I,gr{\~f]8OkI' wXɕV޾!]>PGʪ >Q_1ٳ{#]O"]7zq>urܯVYo| OU:_,={Anڷ^?٠TU*p o(Z|/PcG˻>.!jr''M}vgkچ!?gѼ~>$hm9g>Ɇm|E_QN? xۧ¿?A=>񿃵Kyܠ ]!C\K V:嘅<%X\E4+Z,:u'x\GR*cܘO^YFQ/l;NqX5(EuY]Uѕ2*  AȧWdj?Y5os Ʒs4xOM/kFB5mG$][_y,;L^6oɳ2ye_䧆|{]yDiL_D>?K Nb瞫zs]/|N{jT+AS}?~[_?Ɗ |=?oGuow8|sm؅#M刀C,O⾗?t?[Oq|B𗇵ŗo͍⩃1cb<3̒o6F+aV& Jk͝LE*u[teoH߲gH̨U1@I'rkm Ak~5;Eֹ;T䪿`)/r|'ĝGNsnc^6$3xL^UF|~%%Ojɳ汼!xW+U-U'zj{|(ĵxPӒ5}4NdVQ#PsO>ZZ>IRͣi3䗴6HM##0 U2#Mq)t Msޙ mV;]L6o":YkZ'g̵kZy]֒Z5ug(xkJ񆃨xwYWJw0zzӵTMRإޗYYGsm[UJ61B崋'O,-"Yokv߇:,u{-z6mKLI`8_RѮZ7J k-;asog}J[7i'J2P,S[ۖ_ލێ/렢,i,l9dאXFR4Ȱ((kR|ET^qSiLq*ݳ_-*v4ا˜Zď> xR?/9huY!8BX1qMt+.E RoՍ-UoW$~~v¯Vw&8.6#{~)i^:`̶v"MD[;56)WJmv8kubC~kj9{OƘ$8<y۬OUNZ8U(EumUQEEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEi2N/_x?WMH<5i=ǧ⏌𖸭H|?y\AZ܋S 0Of]¾a`ʳiF*(SYB'jsNn0n;'όSa18ʪrԍ4:Rj R\bTݯ$?R _u:w?5 N8 _d?W"NE@ٯqtWF_X/:; Κ GSQW;!¼ս.Iȿ5On?Ί0 GSS4jm2@:bSB7—A^+܇ s"NE@ٯq4WKoxrxyӧVj%SvMϚx|[0FPtu 1N/ީJ]+$+woE̍"FD/ş^3Ggk?:3? E?c~#_/5?ڏ/n<?|'ӭ]ER<+i|=L rNoO tHW$*`AubzSj$2G/FeQ֣FҥJue(b*I{iZj(;>((7?ୱ΢"OvO߄_'[x' o/dh/ş^3!9L+A?ਿ>LoB><=REOze7|=q6^'.<]޼\>(đ IV. r x<˰٦ |V.5!(NTҫ$VHJ%)E>Î2[QEK Fq87p%EgNuf?"F? E?c~#^A~, 8#?3|?5E(_o_xþ#?~!| g?:e{/>z~cPj/4vfgK[(= 0ήUF)BUR:V*QNRɸE{>)p 9N5bV˖Pj2&%_P+=  wh_7W[񎓢 %/Ik]+Vmi!_i7m?54d_ s\x^0kf. SK B U8ӂo[.i.imݽ'K % 8zSVoœ\ݖv얬3? E?c~#GDn1 gdWq>΢"OvO߄_k Kq~fuOA_w7R>ݩSol$5MXi4RJ_ OKq >JQJN_c馦|AqP*VRB8|=R!׻HA*8Q(i.8a;"iEIH.a3Q~2A'{W :h '  7.fshYRCt joxMKže`I3!em繟OA|B[c%~.UW$l9ãi$drk\\10o5ijӼMD\g9U8e.L-)Ux|?'Ν|ǿJQğN[h>M8urkdeYiivYevIYw%ؒYI9^Sr<ɿ,m I~VE4W$Kȡ'Y"OFIu=I_/|r׌x$K x[C=8`zW ib[g?Hl}N׍.~,h݆- ^4ѣU'1s;0RxtX|~Wת:x_Yʱ4WCKJ<2s/SeK: 54h/~|C^Y(<ԷŖ7!7C_NI+⎦OixVS$+ټ9rivZjZs/|s䐝lFY,^r8o)ӂXpKW:xA-壷_fr:XЭ-d~6ьɽaVRod~W/_ODŽ|Gg|_/t}#M//nl"Wy Aom"J,NG",Idtu%YHee$0 A(O;G>Z_5< >|Þ*/MCW׼!MkQw@͇QE7#ޗ-d}<bq`X~2{aTٹ֩9BTRZpQw=<&΍bq5$ap֯4b墌#ʥY)Br?' mC-&xgÖ4stR>[M}y_6|-`p?g"OXHf6Kl3^ YFg];ÛiP]O' ?b ?f'-u$[wآvw?Qx;ZOWzݯ8.G|3k}C>?4MKK{KxZ%ީsk㿉nk{i0y^K{kE2jީr^WCo r_^M#[@aO"]+Ԕ0n**R8TܪR9Tgjxl- hFtpS ^BjM-YI10T]jI .?V}83_k:V 7_|c[R/xoG%'<54YAᛤִWF4MkEZB"KYX Wuiy`JK)"H XHݥ.~~76?j_д˸IiĿ.q,>Z-+SEMk×2j7)8F6k8 /VsZQb'ůUZe|8W^ YRQc14+ OѥNփ*?qM?|?59LPz~$5o[91_6 #LIe𷈾xˁu-OAd-gsZOse"洚o7V澃MzN+SVUTVyX48vh)󃅶l= 1cקOoqӊo"}?P~~+4a>#}^3=OHot#r:cmz>Ƥ(L~Mm~[Cߍ MHMÿ\Z8nu UGO;ﵖUGYwp52RVNnUEäZ=p{ /h?Bꬩo|N[#_|<ף)xXYa/-$"Kk-;)H>6ݹH_ixOkmg ZY2^$䕘37OG/¿|^!Q;!wg/ڻg |G4. QhoS\<2CxmBͷ eUfN?4[Gթ ߊS]K "]}KZȵf0\cIKL$lq2[2^xlEG ?SQUn֩R/,8pZU5:NaEWQ@Wϟ?i߄czۼI `-O2]5t6L24sjv+2nkQpR8z5+UЧ)[v*+v3V:gp[N]薯 ;W_{_4X/nbO*c޸sD(Ws_^7~)x9woOj6oۥi_ >P/fU" "aZ?_ $TVJLE X\t3Q^!OmG'#_E{˛i'2J>kkR_.?dQ_.Ǟtź Ǐ-oYLt l 8q> %xOm;zm$ݪgVdImܵ#oR'om/3z\EZiƢ^~GE~z|"|5񌶺G}6"]Qm[Spo5@2n5p 6P;;POmsnC<2) ;Xlf_z[+N%HSɵdzaQV5-%AQIj(#(_/][~jnڇ4E?Ԭ?n#z\Xp_Rս>|?ếj(Ofv~;YG @SmCЃ/+5_ޗ?woC t_( H?E#|zغZUA(*~.Y|KoeI5 ޮd2ϣGck}_ڵ^Rab8S9%F!-_R&^,/u'I\[KCH/uxJ6J,iWRoi,ZtToL8a {zt*u!:u (N.(&IeJ%x-J-wM]5QEAAEjV]a6]XYzk"1 "HmmI$7d-[z$FwynZ-Nm]I.XikwյuY-u)c`o?n_/Jx3;K`uKUI.ߣpm M*R΢}HN#:n*r%ҊR`# [J;o5=>чUYEWy{۹i|khO.MvFV nɷZI-`JR/W_D /{c}gX]Ł-ַ1dyNʙ29-#8h?ɔ%MyhKV7׺e힥iuo}acq-=VȒ*$?O!W~ oO?"͇ $v̑ëNbX?5Y ֩g/Ɣ# GЃ_?Ĝ5F_Sы|x\\c5֡QKRo֊o[&α&.FmM4V;m~IMh4C~WnK@K|lX~|Hԯ ƭ}.MwEi.'t}[RKg~61_#)b<&N197\`jf*8ߖ|n-¬/gSqMGU^#mSUynhJsӚ9Nh6Z( _nw΍l<&>_j*:o0o>?,AQE@Q@wW?7jV.&эUl'QL?b} zxx<5߄ZDO \rT'+Ѧ&#͑)Oxw] xI|MmkT=NԴmwDLB@$ӵ [;xde5BG5s пloecQ5ŕ|zlMZIXmĿ Ge5h5 #&cUKPή//zCN?4!"J9?`&,6sBBekT欜WmFE~>}(~4h^:Wtdk?Vt .ޱT<^FU^_OßuE| K~IqJլ$y>o жl] nl/_޿o$3|\^|#Nf>"j?oW*4;ttnj=|FS%Gʵ_JOv\R0Wu[[*+QǧVoH.PRMFVhf?i >:K?j^ >bYϾWM6 x.<qYw8ҮcI` l'UOأQL {SG7Dѕa KYX],MWx⇎g+Zψ|k^ 񯋵Y/5[o\ u{srQU@wy+qC,O r^YY-,U9E#gW(qWĤw{jBqzH䨢? @_5 W{D7ğJ? ܥ~ڒu(?Zzk.Ew +Uծ&7I(x㾃ڑwXW? ky-H\*"^hQξD2 _⧁4÷  ^tQលa'[P*xo: ˴klX|/> d1i_,[`YMVXt鉰}R(2]߃<چ:+%ּGk SZ[mV.AecAii6VߟS?i7mCӾ!oq[IxCIT鑌Wn"H`pTک׵}=΋/#Wþs^64MEhT /uۂܹoʿ ?߲?3@.t/ߴ7O~"u^ S@IhZ&owI5֝sWVGM;YcO:YV#, G\Ja,<%|B J_#-hx6Jŝ&a ?<㵂$DEĄyzlٳo&߳_|@hIx“0,v""|v$Uۆ, o~5į6~#|"A|UnAmA*g]нŅڨN5b *pj.`5KںU:Vs:˳^]NQIԡ?sFmsΜ֊(=SS.#>3.}Uss?7{mF_u)# z;U~߷Bnj4O kR54WZ&5}gJY'УIo7$^1]"RKmWžd?=eC?g}/'m"?Kk, |Q'SISL>uٞ%Z[RIeOǯc[FuJJңOJt{4`ÞkʲѶ?^a< +T࢞'9'5k'.Y/ ?d߃c6O^/Yb0ݶ:u |3ỘdU&Ds*~Uk+;M:O`$$c!DUHEDP _y:gbߖXhsrǢI$?wapt ..ֺN4ԟnzQ\'HR$$I'{5^lRoꖒI/cm$Cn݅ƢI*$5v](i)SW*q=IyE;%u''y#:6s E9l_-n/_Fi|Aجl.jWpؙG8zJ4j8+CUu]JCG˻ӵ[+>LgeŝpB9$jYԚi4M&4M5Ml֍Y}j/?uHa=}_Z̟`u=ދ3 YŲ5Ѵ|EcPѝ M(V5iBjɧdԢLҕj*F)]OOwMhB|.iD_iPj:F#]i:[_17h+I,-%Jpf?~dK3!5HƎeOCq}3[jniޏy6l,/KK_" >gbRL%{QJRsE8$~,#whקeV g},WGo=^1_??qc{^0X.'oʙE)E8{L :l&*<;ȥY1Z9'h ^+r1LHufmт%ƛt_^:u~*~&gztk ĵbc[wG:d$ٸ7$R^}pӜ!AʅTUG=ɩGNh3 *Rxy*oHEtwvEUԬ5㺲$xD=Ձ[#2*c'*tۆ.тu-wGKJEW@QEQOX|G|uڬS(~wOx:4u;[q dy "<S9pI|0/H'"9F yIEz~gÿ1ys& i3op];Ir!˳QE~ RrRu%T/Y,2P`TWRKAETQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3~OK~>7|]Zt?0x}n_=J/3W_{/ԺG{W|oҾO߃>.xf[SV%76wlʹtK?S-ŝHERVHVVN)ʝHIm(N J2]ZgJp ST5iBT$ROV? ?OΣ2r\ .u2оu|;ԵjLucTs_iV.ửXw+kL1_CQfQyX7KeTӿ5|>3|ג9 u?*4h n 'w*ۻO+onXE[㭍\c!IW} oT=pG#)b<&1xP'5\M[urxZk#|-i2kӣ(4QE~~p)_~ &럇> 6?3ᚿ4,Š۹} xƿ:[H|aS3P}Q_ȇQE*s_ƪb>o^~GxQEh!x# ʾUd_gE?"C⏇wj !Oזe-wIWWbe]}Pb08X-GKGBwZ5UJr]z5M3t)bpׂFFҧR,b޻֧x(s/|>{Ě ҤhqxV(5Ù"pX)֤&h>7g:|-i9*+/w*5Nm[ђUt鸹%uGx ~ڿhy>\/:I#k_ |Z?"d_]އo*'4-n Q^3 CPU0غp鿷J%Nn2v}X|E\."&+aӭJ_RҺ?ڇK4oLӵS5{ MSKԬfK-CN-㻱)n{yfXGF*%vkjo' kڧ۾#~wʼnZ3wj*S['GIF# CmN=%(Oqg'ZO⟉_ `jŴ?6~5Gi?usʌxcZ-[]}\an)z׷~ҟ]NAV_ojPxJ{7@g4c1QB^#_\)܃.ʡJ#<\㯵*kJQ{ҍ8^G{8q%Z4"a#nJvJrݰ@@Po{ Jow]F,qZ0픗':ti}~]^8I)6Y8<6 \EiP&+(ӂsbhakcqX|&<5aFzsNJ)o9=#LA?_O,Vfេxo:L~b?=AD4[-6uX~-], S7T ^b/{P15)Y?+ -.L,t7NxlllK{K;;X8-m8mD#ApݯaK|! bs? x~pS9U_Y?ZNa6(qO B ,)Ҍ%'ltn pB%4J7eZS䯣#֢+$+''g~/ًN<5Uu?x.|1zM<_YE:iZtG9,Gz#g& a_(OMşoA_}F_y{a~& S)u{:PNsڸ9.kW+*<< #93t)IPߕC S2SIC<^8IQu"sM5-?ыliw4 ~is鶐[>|c'_$[xĶZ繛̹6oYI4i:fgτZF O_ÍFhoȈ0cB1ox' MH %Oƿ׉l>|,VnCco/'1J2p ;Z ~ʺ75Iy:¿3س4/ U/5yApyi3 㷰/GUQkiV1e˰UZ}iH 5_'7uKa௏"gپ Úg$Uva K$K/w 8c+w<[Ɵ+Wn5kؼ9k=X/4?o3wVFWֈIiZ[4n$β晃a"#Q7F3)ε(BUi~Ѫu!hpMa,=wJtm $8J4)(NN唗+normSŸM<ؿ>/^.:xGdPˮkHʾsƛ|-'U+LcOt|~mݕ/Q\[Mѷ#޾jGR~~/kO Uƌww. mi=B`)v6|g 7ѼE$I%IWUӯ%xuo..Stݮnd{;0\5XkW&q1ZiQ%q8LU&/畡+8Ui7ׂ'GBvГQE|Q@g_~_|2mօxk_i@HtSD\Α]ZM0̟wr5~~*>)|;n/Mcݤ]D^ jC%-kݽZYůu\xWpg|+^\J`uxU))BQvUhԥWn/r =cΕ""P^#8_?&#JTMv2,>x{s[aĺ[}˵d4[^\L[$.; }~_Ǟ~ K¿w_> ^4[JW4qnYx÷>|x.oh6D_« EoKiL6 #O'Ú42Vr[}M#+^Q%(I82q^QviSRJQwRIiPW|z_-ZRG FU}~?x',[s2~or}@M矨?=7T=KEYoWIm.4OLlf{k B(nm.# [h)QYGyniaUXz\V*8xFU)s-!\|r=f7p6 ,E6CJMBvTkTSwJ\bC a,Et^gͬ| m$&x,Mq62SZUzO./'!mׄ|{Vӈ]"RO֡[Ά?k>Xg23]hΙ-:EΛ:uc隍X]Eť\[OM "+jo[?-CX|*ß jz6vI[7گ}:59]]2k MҎ}qcexaq+,sTKhQԕl-J1U(JΥ; S(+rhc› jSu'NT*|m/%f$I$Iy$Mkic$kvUfI>&O$YG 隭ƺI庆? oσ_ 5P񏇼 -*=ʷzu;m*3*H-,!n5}77,4x3;~ ~>X@K3òKI?I~0u J_^%NȮIb,H/ rd*[O%ד}}*Sxsx{xŞ=^Ѯ/ nDZvmOQO)3_|MxĚAt׺׈uK_RlKy%%xSۤPFqR>g)7ucRD6XK)(;jNiGΤT?)S1/ ;Ql*5]G5C8xOWLWGo=^7|OV}Q_*Q3D صֿ"Zпk_?NJhM/4:HJV2X G |MWFƃxSfJa^-u $ڗ1+G ^ZJw4WX%XUiA{tQ{88]4>U֧RWZ5fUUc%|'}Z}jv,yapd‰d-Qx9:_]VvߏȨWWho&1Q¼ȱO'B+Hr\%~߂X<&&KX5 ҊJ8ͥiyb)8SV4Bn);-B(01JNmOF3ӧ/ N2ٜMQ_.$QK<RM4$P4,8w܅DPYPI'{/zƯإ՗Ώ['#9-x öŵ.$u ty20uuW2RNЦzg)Y 3N4s~ iyZ7,y]v6>)}[]$WV$H5x#%[ȸt$pyx;A>i>HB_Ϥ[f/#w/Xn%Mz?:s U5#Ml=)J/޷TeL$RJ2ެRO3^G>DqECpƣ HED@ }iԴ7PVH")kJi6tydi[&|o폄|myK8/8瞼ן蟲? xA߆<6xwP]N:6iiXdijeD~hc(C'BpUJN2M4byINXz.QjQ%$MK首Q\EPEPEPEPEP_qOh5_qOh5<#%W 'Ն8DYD}Q_0W)wE<ܟccoGK_|5WNo XXmM pyfQapԹi^*TJRq4FMO^615a z唹)RSIrJr[c);Y&?>-0M7}Mo^[}/m䶋;KP4[_0cԠ'̴ۇ:ZJo4wB˔|*㚵! M'ZctSTquj.g58! J9O 痔]J}cԞ?g\|C"'yEq]#z.l̴ž1] g] "!j>*П|S_C'W/|I^}R'X+M;Lӭ"HѴk-#Fmt*?1^C}VW׊q\UysTtӊnIJP1WCK<+NJRNPJjJ2m$EWӞ!% |o)<~-_>FD -_w~uow}^N7iWwɵ}?P)zߴt~^#5_ Cy4ys(xnj|E@j:4=_#)b<&if_pJ9} fYNiJX\,BVSVnl~<UbSS ZQªWRk=Z(ޏʂ"_K+3'ğW>ey9%JUa &ՅjvM+TJF1eXx E%QBRjE*93N.Z.?G__Qq?j/*+ObKAT?E(ѫп:o?.?G__WEE x'1_p_&%O6ie$8ŀ>5WGQ@D/ء3YW_\be]}T%OJgm?|v~^e?k? \E}~3x?COM4iW[WiMfH/kMsC=mn!JQ:|;Qx'᷆>5YuOw2xź- &N/_g< =xB/F3bk˛|uh*q9.pe5*{,/tMFԜQqEW~ghj~'x^[Z2T;jGݦ;c?h| 7O$n P\3|D2h"Xn>.Ԭɤ0P*FUUPUT~ 7rSpWsNW48UH4?U%l4>uڶ" _ʲ#L>~8~ld S6ogѬ{>v^>rrךQhigkjW!^EkkIX] _4RZl/n` ?ʳwJ5#h/ab\\w^Դ1.+Pa+C҅jhT4Evi4hhB\>"W9SNj҄_WMYL(2>?oo.Q?uؾ|/0>oEVׁ)+}hBZ8.b kg~[-;~|l[N|| nt+X4 xzLO8Oh͸O3JyO֖*n*ZY_CKuZ]_bQ4*jJ*m zq|Q{-;ⵧ?W<|oR_cwKbKOZ,1d*bt>`mէGF|H(v YS~G^n5k-S_t񎏽"E64 SjZ%ܢTGL}& jʄ9b%Rξ  X+:NjIgN8Xpr]HќT4:;)h_&)z_cykQm<5ֻI?m|2Ak_k:Η.mD,QuPXx=2* lW YNզ(TCBn"VJ;ӄSPzjIJtRX7jեQJQvmY(#(\BsdH:]4lR{`YldzzvM_4  ,Z:ĿWW5vS|?UXՎZ;)k5cN][oOXۙ5o:X̸>z@t-b\!Ȋ9 {QױWGc>xDz*p5n?Hϋc'esv.ZWxO 'ItkRGa]8&sN? XP2Zjvi^~MB!|* d1x/yof4mN_Rɋ^J>P*OsMx{F:PNJʚ/+îb4!O3im1qBFeaΠֺSk}ugWM__AI0om* T8U4EUTPG_P j,y;?Ŀ <mH]e*mt׼Ivd;.e_Ű\ͭW0\DM,2M̒G$l+2dfjڙfdg ϛbx}r{^p*韙=q M-j6kwmwAeC9>>q^;=1=F6Vr~y!P=9"K/#u9A⾓ I&տm6͞EjO{._ꚹtyDVF#$qƥ*źO'/$u}]y6[#uW 䢼yI?cE6r鶲2<"1V#nF~nU}F[IBJVZ.?Q(MtOun?{?_}㹇zp|iyG|?8_o{?m}J~ {ڳd-[ ),O,3RO>cy9lk«UNIԒJ'FN=Ҟ_SԅiӕJ^0|kߍE%M(>f]0j'?BxUf?Ư_៌\gO}xLc9l 4Ok_' VC/5>_u3_0IOǫ*ho]$օZj6ƟZ,+5G#0G|ndZM[_u;Cޠiz[~̷M&TXkFݵ:'m3Fռ1})t/h7DkEmUYF\=zU(ףRTҫ B:8I)FqjQi4ՙ:SZSJU#ө )Bpe+FIvh(ȳ 37վ;hW-9U-f\vym/to`C~mk>(đ߇lvUHNc޾XrjjSAoU)Ƥinx\HHI~AEWq?Lϋ)xM#ú xR.fx<zdYx~o^dܭ$E:Ӛ*:7=88zWgd˰&۫;/QEO텠fCסle~sѹbEWŻ&~;g?@= ^n;Qh^bF_GEWS\gsowm#Csk!|rYτ Il'8'y5C8xOWOcKjnפ+VϦg/ _qQE}!_?OZk\,,]_+k[Y[+^` 3˰5 ǖ9'_/Ĺ>/78WF.9iTTyya;Mg(ʻ5QSQqR\{?̭Sox_|3xڭsywpKkk!.8aFw ~2FȚf bdCt"Gmq_{ȯ>!xX+[3=ԱVR8*XZi6RKke U*n ʬ~Ӣs2JuTB 3zc֭8u)UFh'VWۙn3ϊ|cM#,^EdJy #]UCuEE:pN*qJEF+S)NN򜜤YIͻWڿGys=?m6|; oyCX@GTgW|g)m q&aT֧FI%}?^MGMjJZW>jivrK/ .Lz@Hh+k/ٓDZ!*ڍl28;OK{wG88$ HƊ0QTv ;_etԯZKΔizg4犫0MzMRi}Q_VQ_,H> |*?xhcO7kUJ.l f|BPF Ы^bJrPN1ri&(kZԨENHR䢜m+M&SQ_g/ k=G<r?з'F8 #~ՙn4>P4ωu{ KK\۽q;JV̲(y!,GrbpVSNQXJQNͤҺ7^tF*7 )${;uQEjQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3Q@Q@W| i/k[߳.Vf'{Ldb5K6?hο5>2r^b*ҡJ ZqN 7yNiƝ*sRNѧNF1NM$x~;|l't_ÿO-v玶\X]YoIkK/u+ ~ sGxcLֿZ?jKC m1_ um_:BfN$𽋺y76e3?^5_ ~}_߇Gxcӡ4m&6iCo5ē^:Ϩj֣]]_]\\Ka3X¬eJy-p$6bm)mT%f~< VΩ<> T -Y5 7;UNR: t~4{BmaҴ]FNt2ROӬ-`DU@#aO>?5p<>Ÿ(|j¶YLnmo,6zޭϷ㔗 $x$VI,v%GEWQ_O ,K>~~'_zv>|2 |[xn[ 5b<wgŴKhFeWR aV*1)ZZ!hߩ뢻= -X 'UGk.HZ9Ti[݋~Ec C?OO?(V?3t΢ #6i+V</)tTW.+Lj:~ QGBçua?ޗ?qlU[:**YE<Ѯv, sTUEP@> (xkLU!D/ء3YW__U?Srҙ[Ot%|dfO_G(M⟄/tkMXۭDžQjj NT>/X tymql>Ɖ#\Eyo^%'¿Ͻ^ u2͍SYcΑz#:ũ3\6Is\dPi*V*0oOi^F{qGn]p :\MXӋjzΤ)AJ,]K )o 3ǯ-WER ( $:"ZxY5x!s,VqsLd8DzǙ}U:0QJ?f#G.8xR(w|ޜI9No'(γۋGDx@Y|sᶽu BC%Cn5M"QGmj o7{/u-W6KO+n :Z~ɨx[xYo5o79ok۵=OFi?qE} q{*Cnu2_4sI(S RZ^ZUG-b!*ǖ[/5bӅh-ҝH]smseqqgyo=ݤ]Z$HOoq<2G,R*PW_Mk77_OF|o7#m?X pi5-Q|~~Пi}ߴod|`l ^|>֧O]BIGr[۲xkΆ7()S--l2]qg8w)` kኗիZu^VKgh2@o_ h̚xD/ؓ'̼<#_mMi_*J/oƟٯ5߂_jK$Vv< ?b5޵ZYkVAtn/-eL.[9pfmɫ*8rܕxi!3L1XdQd)j77 5ٳ '࿅|2OLETIIuӨ|4 h)'7|Fq-G;_KukyZGSxF5x:ׂ0|'"MqkcV >:ޑ-V͕u7 9ÿ'æng|Pgx7?jzFZxt |<= xx>E,>"? O-ԅ:9WnMhէ:j'RyD _n=RUf4^ڍO_vYt? [""K]KwP\i:GkR?$(( 8`4bE(BGQT8DPTP_*;xŗC_iiV^.vD"sՍψ"յMUpjQKiNy'7\JN18]i&Qj1ڻImᶑ?ğ~#x# yOzlzCӦԇ)E#|K /|!V+jl$$IehzƗ8mg(rJKz??Ş%Ӭo>_IxŰׯ]Vp=)ү|/<_5o-k1;w U0BWě/|Oԧm5i:Nr x\rdY+ x y1ﰘL6i48O,T_9}R|_ %8MsMNT$ӏ:]KI.w[|5Α 29+TSh"~&O3|L'g :1Ԏ_CjW8ڣtl\zke1/u.ZNvY^VMom}2#yf^:Zw0 ビO9F4???6fgǷ&V㼿1_k]9x\~u_2.XinKfQm=J|xŶ0旡xSTTmO5': ҍҥHYಿog?j(|WKź6e׼iz~9oot̛m3?5#jdx_"7[e P \藖4;FO ]hvVjMk-6rCrJ__U?G[߶^ %\Ii:m=>;Xy߇tum-A줸ӭشJpQCS5U &aڍ L竀s\MT ^f)fi5S0N.e*я SOHR6')_> 9OWų?u˽CW<O ׾/L5>?xO_<[^F,QyI7~|/.we۽|6ږuqcȡ_Z/t7¾<;&B4=E]vZm0U (!n;#;="Y..mnYry 8\eXbʾib1SSUQQ9RHEFa҅EFӓIt:r,uRHB">V4RsrfҴ/?௏?'i~ @|) ;_|shVW~AwqY[at E]SIkmJM4H,↓< ^Z7>xC'|Y5RMk{i:A1\[N]G=vfž ik(ti$Z,]{s4@a5~~&^X|3xv/gyÓG(xoMiX$NJo&P񆮰ε5z"EջlO16>޿J ,?R~zF_]M?_q,\sz}gJ_)aI~ \vRk (# ? ~(׍bzO jlIZgV]~xKij?yXɢD zs]8JxKUbe^\+IUPljh(fZ8 t9qn.)*_?qc{_5LJdC<%L0m;@p'/q98z)uR;NjkU~ \.lxQ~E~EWޟ4Q]jxRI[$r*r'5GGі̫+) A pni(_uFRbߢo9*+KRѵ-_IԴ;#Ԭ.]j\623qYM&i֩4 5M>X(b> IwcxKE^&?l_u HuXRқW~(K[ URJQoE$^IK+Oi=_%οێ?0_ ?:Ϯ|G~_B ( ((((8PRS'Wš8PRS'WšyA",YU?>(+9Ɵ*P{ ?<]=e?5)O붗]iΝ&CkYZA)nL'^?.ׁS>:*u)Y8IppQjQdM4w=\1wq,FIJ2RN2ijng: F9%Ruw'=rK̥}Elf4̿|GgZ?_`o_^x30+} ߳M"Heq}c. _TivY[iMYDY}VV'݆"c4A ErWbq-% kn.-JUKxKb":ׄz 볳kNCEWQE|X~fmj.-.`g iwJֺEyxwOGR %GEe:УW^%V":iV:p칧9(ȫViԭVJBu*N[B"9?(6-Y2L_">_~~0X_ ºlS$M IOn5wm6Pr\(yn7$'V'NJќ<EOb-uGeEWvr47$xkT_O_Ǟ-Z +[[zi}_{uk*w]MQ(eE2Nū45{ II8)FI+4iL"O٧ #xyxSEf|kCguyy.ƺZ%W~<]i><' ̾)w^:M喩yI_?3mkVլiO|<|;ڴg|_."n󎍣FEv-u_hVń 62s>l֭lDc8l&':te*{3_|gCῃmG~=]%{@s__>9(}cO$gt*bsȪ{s8vP(L?-~? =j:G>;ŧY~-ҵsm osugiq<⮗c{;ZgMx?P>^-ɣZn3>|Tmeh=v߇u{K+-c_<7tj xFd7|EJ>#Ҽ7x⇍u5=$Y|S]kEf\Wz{)|?}~"UΕAxRYֵ%GX7u\xℾ& V-soj:w\v?!1us>#=b>6N.u)(ӋZ*jYU0RXL:t]F3noJuj+5Nq{U ^ moE~!L4kBm_tie[hf<>/Ǒv[^JT:R[]8(/iBQn26z ٦_iE٧ѭ{4¿ S-G۹"̹4{V̹h4S!ycЮOǾ Ŀx׋WR  ~О6ukZZjVn4E[)R ?')ρ㼾iu߅~>kf>$|94?ٲon"9$mvz͗5 ߍ9|#fYMZWSI{Y{jIo*e&yR#a[*Z()(8I{HO8'4ک?GOڽ (}+Bӣc<{;Ty~S}ߙiOo}/zuOeX ydcӎkP߽' su [ݾ/̩b4=0?ryw9|Q@$sr׌̸<x\6@NOZpK[Ky~{[y7oN~!]U1$(S?^ZrI'ԓ%č$Y< )?zX? o|+=O7uo)m'--ƉǮlϤ[Y_j%F xL4J8O'a&l?t~6J}7ǟωm>"E>E_ m-/Y6uqxJo.9M(Y*eY//7¯ j6ƽi)ڍ#Nc i~މ-JCfKEg}M>=~<co<[[&_׵CW5 _W/u][Uu=OQPu 乽yn.o.eIgGWy+-\Epż^WTZh^XL-(R̩ƬQUHGPጢРctݽ~ztWTIViM?rX;A~¾k>(Gi "h0xď7ë[g~"YƏ _X׮a3ew_>|V1O_ Wmr =+ eM}Z'ֱ j쥖Y^jNƿ Yo  /kl_}ʚh̋/ueJO/K3^ g_ip[0҄u9GKI}Zբ)ekJ8 LkPp3>JҎ4ս*Z3>o~ c4|{'ះ-<7}(--ޥ]mI5=w[gּA\wkzxsw+^u$c4Yp_Rt@=˭B =R&Q5_jURuNuj֩:jԓUNrr)sJM&mS)408aN+Ucb-4 k^[&Ҿ~ 4-Zj5{ő5cOCoe }Wv˴ ?ֿ)d9~:mL=\)FyGՄZy}I{45.y+ aqOEU!Z-Tҳk]Vm8YVUA9 {l# b^?)fg+WV vˍiվmo2XtJZJSյCZkBw%A'jgWb??e<[]c%o|B4;=gI+ x2O~-b3EHP%ֵ1\HDHJ4n|-V񏉾-j;–Rxo:|YT禙7٧SSͱb-P%Kδ%$vE7x] )]JszoM+]OA`g#?p7k8zo=$0S8(E>T+gkB]+Q3D ص־ ><_hu M[GusKӵ2J\ڭcpR{KH$6=+4?iO:w~ 3K= [-kI3sy$v7~͛XYK$6o<%Ok4hx hmeݞ٤[y G"23J^.XTQMTS6Qx.t'NQnK.hM/wߕ)+ٯ;5Z}oYhZj02k+ x5$iMjzTM6N>nJ.4Ok?;tZ~Wm|Qy۩ (('.f2HOv?|_{xGZҢo"͹{jZLLH5``1XY$R6h{~~mlӂ<.*dPݦqnݝC\O>'/<Mp zwmf7u$2FOGE=s * ApAAҿ ]RRn,uKk;'.-CeDua_C_}L'B~"vl8}%'nOF%F;=%%N"w:ϯKM잚;}RtɭUݞh (B>T+2~!2oX>G|eºΝzBk=OLe nBb"|i;iCCqr ޯȥBN2e'EfviOTϺM4iMjzѦa__'G7BtW WOq/8C*_5\.(=qoOg_4߃R|:n8|4>?(肊((((OCKaO_ kOCKaO_ kxGJO 9qfT0(`ۯ7CS )׏f__nRk縻I^%qAr_HOj(鐢((C~W_#)b<&<*(y1_?j(ЯG |5#~?|L__uqh+u>?~,o_$6qS-զ ~'1?((U&эU}\1)?BG5u|> (xkLUOTV?GIAET,u j?Y5.!kڏM_x?ro4?(?l2&MQ_G_,.?Cp_z_W2!,䠗?sD4QE+(?uAcW5+[>!_.o?R`cXOSӥo A#E_W?4}ծ;TG.r^|B- \ szsN帱4+ pW9?kԇ5 Lʥ׻iږ_&+EntL;~WZa8`mP G6#^*!9J+z@>ȷOZ_lTPhHּU#nqG'¹&waxG >> Gѥφ'pʇ`hhpӚx{/rNN:%M'X|ZOeK8F3_)B~j?h~,)ISNӢYѼ?Cgx_A{iVm=X-EhҧCJ 4JqJ"SB)h[#RYʭYέIu*JSrܥ&mŠ+ +Ri j",VfkKFҴ q_^%q-$95S/˩,]]r#խ' rNӣJM9_\TɲxG ^2b *\ьiQiBTI:WU?i|_xCĞ9Nc hwuĊ{(@Aa_8ӄ\9FSrҌR[IugJJ1rQS$oKV|9}O' 6o>~2@N K3 4>|Bh_L#?Ec YoI//S}9i_Mu <5mq*-O>)B-KYy?I9ibMR)ZqzRc%F:xҖ:PPG]SdN2V)ԌV_fTѣJɣץ1M.w%FF P}z~ni IbW ; +>94wJ{_w_|0lմ3Dm|WKi­-ޑtgSN_\e?^m=gkhxs"ռ?z kK$xQ|)? oς~#SC5گ>js[t캍_sgp<*?^+ YeJ_MWz>4UmR"gVsQ9^ͲF6UJzޔ6thIIjo'Ĺ|2xOS/ _2a#DƝEl][б&[)5K~Bc=~'|,m_ğxk񮅧x iſ- qevv7Qwg<1E*.;|G|[^ݼiV>yX˨Y@f ꚇ6/ke ER?2]*Xn%,)N{J)WNOaZ>zQ8s9sX ,-Yƞ&HT*ЏG)SkG'=?׏_bx!=q_/*{/:ߋXG|TgH̸?gJpNG| 5ؓ+&߳|!mrF~7 q;A(q/ WKrYF2Ӕv~:c8m{N)UɳrpI 4ޟ NP?,5˻p$$k9P$^Z/|3#]^|FRAv'ă=ߗ6b4c?O p>2eڻZ{wn{j2&E𮙪~&h*j# !c3o8?'6JYxɇ퍝F*᭯1v߀"'a)V_)/Kܢ?&Wx_ ig'T[~%nO4_ 5x-ܦ%*4.?ۯ ~zNsF^hw$fP@x⏉^;8˽'L}xk:^?ಿ oOJT>Fÿٟs٪x?KVX|;E|EXC-=x_|U/zNj|ccPM BU5oTQ5]FIno/o.%yiݘ_5a3o1|hK/|=U_*y|ʤ&Z 7ӄ!V-PTeR'p*~SUbt٥s𑼔*_|ҕ6EQ7?|Q/:]cP|K:kԗ7rKs{{w4#1nEbx71? >g>6񞹧xk~뺽vznX+quws*E"g{EfZ:&EtmWĞ%&^auZ]EcFcך^ 2]\K0?D EV>4-t6?xoXu_]FfmuK9nWbF˸uHm& qR 74NZ4gKK3V븲b2@;'9S 2_{%| :빇"PG}k~z}8RuۿVw轪=9?Og(=}*(4xw>\Avbdb] f27.JHO ~%iqK%mn=i#mћ:-<v"]4OΟᯌ}$.;x"EW84trXA${?xYq2S< T'>Z*Y(e% ~_l u,i zԡjM## 2A ?_UG/MwxRhŵH$|6H7'cH{̷"?J |h6o@Mv !еAci-ųH$D%os*ɲ8RwT1ZK5bΓm.qVrM}gX;lSntd涰ofF-mg^෍~x¾0ahzr#Zj8Tncr^OW($I_RN(V8ԥR*P( nI'JrR.%ftkUW#f.|մ[k\8uM8 imQ$4*ҥ^֧ .Yө(IofӳI&H!RtNREz54~O mmbO|3QUgcZ>>ib->zTus]F0O?waN54ޓl͎Zܨళҿ( 䒟?E7~H+(~2rKI[=Ef*< CI_^|y&oê < .fUEmѦHQF0ӴG%ŌC WaT -PT`}e);rvWܤnB|;6:wOFK&/ yaVo+_ WO/x;<-\Rt_/Ė=ӷx5=&+x?,`GE~ø9y҇ժwRT&]DRg/kJ󷤜 (?ػ_iGx'RÎihǩv4ͻҞXa@~O|N홸/ûk{5/Jۓ& *X\2|P3~N-M"l*a*h@xy.!Л H2)#G"+ee`UA~INGUPVP}b3\Nt\nH,aeT?e)nRWg{ugsE~؟.T~#MrѣN[M1Rj;6}qUժS)E;5ti;6kQ]F?_~ I_qoOg_~m/gp#/!Q_}QEQEQEQEWi(~)Z+M~Ww ]?|E]4YG ZT$Ei4k3QCan{ym%BDGgYFeZ'G/8ڰNJMNP(Ǚ-N I3ß+Vgxeq__nRk&?>I3߁?J?'K_~^ uGGi:ߎo/x_ZX-jZt@ֵ=6_YLR.uT %9vq نYRZx%N1XZ!*B2rqʝއnYk̲eLf_*xLnR0%PZYFhǙ+& +t((+x}?P?!~7 j{[t=+_˦Ol<;h*cnF"hHx/=pse*X:xeM֗0uUjR^v~aJZ:jXU XiZ/jWkhG&?>I3??I2χR|Lrß+Vgxeq_ǧg¿q??I2χR|L澽bS-km>!\w~2A|I.sᨵHt9nOem:-oTH[ B~3C%N<iGөTc|n>wKVj%A^{7MasF+VRWuԥU:n^C( ?N (?^>o^%Ifv~f,g,$ܜ?I2χR|L濦8_ٙދ}`W!qAo__o򸢿S,y'nh&?>I3xsy p4?;-_=?Nȅ<5k*ꭍegX¶VVp)fX-mbH-RV(D٘195j)-WmEr1X+QRPWֿ-dU77 9q4~dydY%啋8,I'_xsw<\n'E`/Ƅ>{z-rr^5%,%|5_êչy=*77.Y_)Lі|<“g74Êe?~?W78/+H5Qguz}q)Lі|<“g754 yy|0so 5}e4/_ KU/"\iqGdq8,YcS ,irRx7>v˒Ni^2,XZo V% Ws*RN(S*w{Q_?W_c[|U|6$k\jƭWLfww?,I,#kj~,I.GE}qFs.M*i֣7'Ԍ\iS:j瓛vwFs 29:5!RtQT Eٶ8+#o; z~ɳ_ş hq>5|;'~/|`̐ͮt"I''7CIuwM ^n|M5͟3dWƺ=ȌYM?_|pQq-9帎T^\.)J񏷙7%w,3i}X7kֽ!J+/~#J< ,~1xXG ?l-㕂D>??M^I+;<!_0Wm"XxvZ`3<}]yyCAYUY_zX_ z}kKJ"h(S_?c"ڽoWWkQx$ƻmG灗N&|9Zya]'Y#~M[oBӤ~6H:O¿ ˸^[[Qo^4k[Q_qG\AĴamM'W2h8*4&FM&}GNK87 cĨڔУr'Ru娓h(ЯO-o5]Kla'OPƿo!wcűi uzeGRH$v%r~#پcjPk w['~#i0ФPyѵ :͓8Bb} S_ګ$2&;8iS-bѪ4|hy9^-c\[~Lf"uNiV֫ۯ DҼ3hl`4?Z~i˲OҴHl4t0D;cFxZ(mmmݶޭmY+$Z$KdQE(+b~k+7i-+4ZDXu9H`t=mw^$of7:!d͟g_F ~0ӤMS.L-rD5+4%?p~.pYcuR\jTdV%&xA,,I{x 'qqW{*r&G+]# 'x&o6~'_:σF7c^OQY!x&(M^Oqywv#eX#o᷎>RωZD>xZwt72[%si1MĦR.m/Ybvh?~||g|,EGr F )V V]M8GsjՌ)7ZW%*乭L5s ]'IFl8/^ӍfڿڼC^ X5YxڳCּ) MOÚDLKi>CG@F\=zrZIѭJjӧV*BK$Fu!V:N#Rg JOZkɅVN~5YҼ;M5]-4E4y. SV/淲ӴXkh#iHјfQmI6z$նIn[vMշIn5]~%5xWԵkz֩s-j^5O WxZ xwM5[nct#K{BXඵI]?/h?^Ck:O>8"<1/ZGQpK+4v~am\Zi.muj׶z}_m!6ujŤ~&~^"Lz_c[G'Y,|O-=jIbҼ?5\[_`Tr+A[NJ5*-a%UqΝ%9=,O->jXJr_Z- wגw4쮥Q6oCO ~H~zVYGXRqxz3=y,Y;GL[ BuHQ_9wa[2jPݪTi`r:[2%< F{ά\jΤ칤IF*0b(+Ȼ#u+ ?DTI4^~UeA(Q}|{"쟴@;Qo^Rи0c]h_3 CQ5ir5TQaQEtQ@Oᆛw?Z1O|X[SMio ԋceWR $oh?U.k[o|{|ffFᧁm5+002hJ[]cw|ֶ0Iu{r\{;hKqu0˷5i%4 k &U|[E %xoK;ȉP\;G`3e.WidNSz*^S.7[xrz&f;}UBx/Ί(=_<7uOhVsI+$w]E.C0KYcr$@|j{A|z«^U62ӡ>Q>MMkkMK<=TFOK$^%칹Ì˰5Q+F=ڋjKJIkk=O#U5mJ4GF-ujW:}\Z] /̑YYx>MX]u&rֳ]A$֒IYmE'*_0x[O ~RJےkm pAqi,^Bz]pN^Q[]|nEaZH59~ q~Q_׿L29:w~!Z!<-xr/*?L |G񴩞V= #;\}z rK_O^yaoJ$ $2I=:g-MJǞ%ռEgint FTnQp:Ik?|1<3A'UW[?5dNHƙm4 V"]/Qe)Jk3z\=^ҥQ묪MzEEEh@Cj-h3yK *ښNe/jYvug`+=08zbsgMJQ[^\^\={^{&Ydw`  Np=LTTUJ1TT\|I+Zvu1RP?i̯e(ۖ2ٹ=~_I?-<[wzy_/az~)ʞ:{ƹ,N{GYC[m&?HmO_56$ X䍕5 ee`YH AW҃==rS.!p"# J)“WFJ\}v)s[N[_[{V ZUNqܝ~h mk؎ha[{xx&eheR,N$DfI#u*J _?? ..|oO wƺ%H۶Y47ZN+q[FkŠ03-pMsԪ%jS~zJ7n(b^_ xIjW[;ZI u<} ksy\űJԓ7l@/ V}?TԬ.sem gs\$ʇȌҾogq8ᦗI><0#cԥwk}$Ӥ9q`BZ^xYF[kDW5<$_k4o># մ T׆ǫ^7ywe=->3EFǦ!}{W.dVq<0[S/5Vw+?(kO&”#>rţxnȟDT{<gm4r'0=D#=SMSRTTr|Ta*#&~V/o^;?go KK),}v7us+4/Mct./Vzu}womQ'}+̯k 7U’^n4[sÕ&]U(JmsO޼Wc_<~Sx/pG^W^KogiPQ4՗L@r n6[PtN(1rSm$=s<)ەIy[Š(, ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( we[8 Y)I/߄<}7G_u9b? p`tO8 {=?ߓL#Жr-&3ėNuׁ8;Y?O<O^ _:<g5X|7\a>iWeK[X\o&I_tn*+*G/'Oa?jÝ]^G=Zq8$/#-co5;{H}_HCN*?o;29־5z LPQ- >Ĭ b,Uq ^OeZ2rmg?oa  ><;~m E,̱K}>0; ORo^hڏ~>'%햭a/D A%I=/KJ%ֵ]*[7m)?o?`j j( s./>+.d4SXҮ5u[gMi5}7R| ox$pd#UpY/eԥ:iuPa{:k:qzjPujV/G&O^G&2n5T`ZZe HK|$ҵ2ڷ~qi Y4i-DMW>DŽ|9p5gNO]c~ h|T~1~1<{m|?Mi߃<7h"/FriU qpj:ڭ$ԓ_q~e9))F-Y6NubR*҅ Oqy>˝T{%#҄Jj[8'񯭿bc~0|<6/a?s&׈'NM}o5v=꺉[S'~?Q CED~)z_Rݞ%im6+FYyojq/ti}[Kԟ+~_YE':|?|-Vۏxźц(/|UOxw8RfqmnfYXiֳ&e9vTf՜$e򵹱S^ּzaiI4Z1\5xc-mr1qڄdRON- 3P V㟊{o6 khf,ˡ[Ɠxz{Nk{;j_tQ_cqu&/5Z]'Jф tN#L&Q =(ӧMY.\'&97)6aEWQE/GooзaWwHmS^4Ks=:ି]6WMak9P&ԣϡuly!kˣͅ?S~7˖[t8+;ߴgُh/>EA0׍-u c[NЬ%#dL}C,-bcFU?ࡿOĺ%O~ZNm#\|HωlbKsᇅImQ1co;7 iףJ׼[zuͭly9l5*`_f^U~RAul,Ҧq=>0xkO|^:m-BmZ^mLO.?uG;'z.\F[:W:jTV)NTBJ҄'KMwG Ƥ!RRHpJ2JQ}i * (8[Ƃu/"/ =≴K\U,! ߌ|aokhiD7#t=2Z4jb*(TVMR!9ɨ RQMR)BU*>XE]$RmF1WrI&GwD𾁧\aiQz=i@Oxjs^%&qm|#5ٮ[xWInd$5㻟 Ez/~~!@dVvi3ʸׇ. ֍j:Wb-nSxm;Ga៌txkCtW<)/1/}ޟya,B0ķb`- \!>):8•lF& n1x4bm̨Tq^ MxE/gpќP.DڥRX)Fi OU)#/./i?Po_5o -\i &ž.,kxM]Zյ{_hշugVA~ɟ <]6G0AktoxO|ĺ<_i4]nŗOk{ ~+A0 P񯊾!ķm}x^MMf_?QuDU!,‰ J"">fx<' s,v&.?5h:X83*kj]9F7:#,%֭ሥxj2N9sj3N ]MJc: 5/g Odk:G5~Sgxg?] ]>b nuDziUK}],-_|+o|m&C&Ug=.-[wnT +Wgdžmq=73}~ot_|`/|3ÓxfU^4ɧNԯѼ'=f-SH$uH]UІGF A~'q6WRy^_ ʌ,NaM•u}MRtR|G7Z4kF2/x{%aX]UTpN:Mq\?({7RaacXiz]ivam )oieeinZG0CE**h C1O91JYsGN-w{{o9 @}7V״+DSioo[zb*(ɷP/y|Wܾ̑\_/]o>-nk<~2j.[hY%:p/8ɥu,ҹW04`n/~ x7Q43OZA|@uñear#iAz5-?jZ+wS2 ~'k* E&䅁]T[ƽ $p Ғ3tMTJ%T'>#?ƄaLx+R%.U[-V% P?4}hLF4xC|:3Ίk^\|x ]3l,>l^Wo2V Z_c^G^_hS2J[]> ᖡ31<*e+oS??QZD|f_į~>Pg?"_J<5xυD^#񝵦'џ[+CLK[+ s"oi7VjZxOF% hU/IUaq%eY R54U3|!K#:Sc'N))MUcQI5嵣(*Y~*%S3CjsS N콿n{4ǧj<9~~g"Mc]ƶsX"Mj/,YmWNjy"7|{%b :d|LM֥LUgӮq̖\?袊ఖy j-&j7,}pݎe8bʤz¼>_M Eb-.~|{g(sm 9;xVy I–^\ֵ;6 Ox$[a=^߃4 'ž? 0i5hZ.m?I{];MO K;h`~XQnQ^ngfġ,[.Z4O ˆэ<664)Sقp9te7z4U}WZRO(ࢊ((((((((((((((((((((((((((((((((((((((((((((((((((((~)#!| Q|G<ڸ~i^$tu_1ŗĹ;95{='ƗzMurjQG/  ;?K x~*|/NٚnuxOxA>;_^!!𾿧 G.n#-%wygf~-.Oo? >%^\T[xå<r+S]=~M]'⿄4Zl4_Úĥn3IglZo=WZY\n&j\% J-l=QeWʭJPnKq|ofTA`!Iįg EZXz5RjTRr^.V՟#Iۏ L -Oma$ .K,uP6e ߌV~uHgԭMS ݯg? I8oBOM{QH6-VHZom3FGYÿAFxkMk OӭbRV8N[۬WrsI?escu>(_u V] ֵDĺHzNLb^ѷ|[ -hC4΢N5Qi֧NMUiҌ%ZiՒoYs e|m:aNtViis*qMnI;??a/"'Eď>7|_[_ Z=<g(:&a/صsY .ek?Ydֵ> Aƺ_ۡ_ |[\*̈,< f6ZNKSu oIGU>/>U5 WT5m69/Byo-.bX7!(Neif4158Wqh΍,,2n*Sٯ eyWKGS V(Яʗ,ӿh.DUO]Οke_ ?-!Ed_o겿1ƶ[Qt|&mCK(IJH¤'Uw#Zօ)OXxZ*#pşj?MȓO㧁|EмQWZu  G 7Tc9R0jO sͥ_.xTc֕j-W湾cjf*3Vԩdߖ*pQFniҌ`oS`40Чv );sNssRV\Ӝ'dIQEya xk׼=GWS>$׈tM_B״MVK=KI4IX'GDeb+~3UL~jg׼i]:lK\+S_ lAEGڼI9?c{AB#A=A^-xOL=WUoqۙ+U\iҕJS܃὆*.iT$_+/iJOi]8FqK k++n-&EI`TIa'Y"ѕ-7[t:fYxI,ZfӼ?V kIk_S5XIӵ/Y=Tn~~W#?|u{c_ nb:_>Sڋ3VWGR4KS-(wo_.]߅>=K4'tMBHGV4_7.,AGTov1kc.S)䡍R4'*t\SnU9ATՏ"UcO a 9(RM;UKZURoI´3)A//5σ.¿3?2u^]qYYw>#sî d_83Rj剿ga)QQZ'jUٳ\: WU9qi:ps邨jiz6ZFX^jCcizfo%^ܼvvVVswuq$p3 łBY I9$=?Vja^{t?xO_/Dm> k+xfFn /~SK25R0x:Us ª~}jWg .J_ÏƬ$NXUV0m"Х W+SN?yjT)*tf_٪Ua-^{x]4sSQIW)Tbew͉Uc<<ƴ\^"L^:MF.NzT҅ +KQM5{Q^!Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@x-?>~syma-f.#ɩ[6i?F!.}[HՒ-%̧(h׭NZINj3*涕:q$J-5ёR:Е*VӌԄg BIIM4cMjS?G@KƝGǻkwK!iG–xL`\G&F^xW>$_׈atٻ)BA_xow+yg KEƿ*dZMܤQ_e^-f_N4150?F~Mz'Q*}[>39.n2J5uJ* t'J+G~_?gV/XypZ迴?Q|/_ij_ l[Q<fvoaN?`/o.q>'q" i{O*g:Z-̐ɬEy9sNi."wRP06n:#/N/snZSBQZz:v_ G^waoV.  xz /@φ4?AZm;GѴ{M;MO K+hm^5E|d֜9TSEF>ԗ8ҍMZ7QO(_GT.uʠ?zvJN͵ܷmQXQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ endstream endobj 18 0 obj <> stream xwTTϽwz0tzRWQf "*QD)  EbE Q{@QldFJ|yy=gs{ߵ.$/?./ '{#~<s P +=KE$^o{4+/ 6'%<2YSS %(by1'.gEv3;8 v[="ޑ-q~6#"JqEVaf"+If"&C]E) \3IKnnkˠ{qrR9q iLY2EE6601PuoJEzg_f : !$E}k>4$ v999&\D\?xCw$0nt!dqys8|O.2./Qn+\j? Z$J'@5RTP"@bv5Bmrq? Sb#958ğ%@TT&{܁ ,` `7*A 4.(,x !Bd)@j6dY@ hAP%B)@ʐ:Bz[(2CaPeGyP,T&j#U:jGnPOh2ZmC{#щt> ݀nC_B'Я1 xa0ɘu"L+Ư]~ M%8B Ʉ-rB %H \fb98 q$C2 bHB.y]K2Cv"G]FE#[ [bDDMxImIgUk%$OJHHt\RNIHISͥӤJO`etde2y2e.ʌS&ŕ¢lS.Q&.՛L-~CZʆˮ=#;JCh:4oZ*v6L{/",Ǒ)"wS.TUWhxIdh&hjvkjikjֺfh'i~]CgJW^[wn=^^m}>C?E  ɠ`6604BFIc&4?\ZѦ{L{M?Y՛71152eQeq{ yǒMK:4XcEnmƚob=megSm3 2E+h[MmY Nbolbd?Tw)giq C2e:;2;i:&9?w1sỴqsz qt+pwqst1ik׈7˻{gO/7ķ߯`r7an`fA'{C(!!M!C]BC ú%cDEDFFnōFG7Dϭp_oDUL~JݕW^]*uՙXXf8t\D\Sf9_?reg=c;KN g2!$a*!qotcRY ו[}\&% HBjDjk.-.OIWM_>a1i/soȂVfu >pp,{YvUۜ𜓫WV1XsZ_Cc^~ j7B7voܔib[[Rk[jk֮ھ7iUgd%;png.$^1힠K\|׹+]=uq>~hoa{kpٛ7/ruCˇÆČaߙzŽ{7?@?(x(l=368q~0lRmqb+N> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" )OWo/=w|               gh7[                 n hZ/g3/UqnSNԻu6tvCWs|R=q>WgɠSlϫOl>?4>gq=~#ztc @K@p"9n{;8kWkanep2 ˲ 5FLA.gP<9bߏP1P^*ٳ9psm֩wᛝ=54{󕩳~9De&yaitzަα,@Q\&b뫗ons-;AlW7D 7i0^@N l9{4k[ j(13 7S z|Ιxr_=?s*kq6,CE^kN~Ύ; ~|SwDHmv|hw; sNIH2j7ȬP>gL<9b< >2qqev\aqev\aqev\aqev\aqǪqevz?d03;[zT47ꛠ8}DbqtzZDgQ,EWqvDu鞰Ľ/lt(< 0&$\Χ+8FΰeZovy]sS鞬<ǧc W_oS9'$_h>rtzZV'_g^0>gL`5 WԒ;cĎN6U1sX՝RUTvZvW 0N<1Hc"q $#{w[wLni1$0:|ΙgkhѸr}6m⽩57u ޮ<{ Mf=>~δw u3lKecsJ8}[]//vk.MYҒײ WVݾ/k<2 0opNoo7H21"bO=P8key,IrFVRv (fQ} (9kXwxb&.pظr9{[6?װudiwnms;pps_IXA{sG`t$?c`o|vOЛ`o;;GYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$urGYg$uDx}4}߄`x}4}߄`x}4}߄`x}4}߄`x5_w=xm6ڃm6ڃm6ڃm6ڃmK}8t\:Np蹣掓:Nh9掓:Nh9掓:Nh9掓:M]R\mAmAӓm6ڃm6cq6ڃm6ڃm&R ƘiƘiƘiƘiƘi ֐kf\\\\4:x9玃:x9玃:x9âs$9âsE8t\sE8t\sE8t\:Nh9yHpWTWaR OgL&"AHL"D$BDHL"@xd8]ƞE&Xy"``,s&& d"bAIL0gx-- kPn p"`LM7Rgm7ĈH$DDLtq;6תuy:<<"AkkPI z(7R  kA(kYʎf"f$!5wO"HHb&$c%]Qd@1$H"BG6"Dz&6y H$HĐI &u8fHA"fOssR($LSV%aa3A!" Y5wO1(F9bSUU$HL 00 @:\ޑ@uTPN W_Q"b`&1 L:}~G\p{^UI10&4nxy[zk xij(D Ka[d&vw !P  @;'88NyXcɽ`S0<~dA6]y95I+x=X{cǽ>>yYD:ѬMP =};ƙ˦&"P a2Iu8hȜI9ahugOqGP,ML`@"`-sl&qP&;[9C k:"` @D0N421D&0$ŐŐB% , ƴk[#GWDկ.$@'oy LI(8ɑ Hq8Ā5e9Hq9u}w$U3yܽNbH%g }B$DLLt}- _u t4G"N'M':N:7#zt`4$hɺ1:Po4di 9hj T@"HLDF=\ᜲ!0&SJ$1"$$0.<(0 [dI Hp~on9puc:8sB4FHn5Tlk|Q%dX0#&"g=5so"&$"DL A$ET|Cwny{ST3$ $(0`'gWhr1Ikx:'7 L#1Ng7s:UXLĉ $LH&0$"`Hc{L q(@ n^zu/?᭱^#i1f @I(LHξ1"7ӑv9(n/@ژIȂHHHLL A t~އXḀNtlj%sA+ۋL,ș$ %HA3`p D2DY&tbjW[`+#3,̜șĉ((&8+"\_<ɷW%L/=uJ$Ą  %t~އH*ɘLDaZzTs:yɿ8tIsJyt\: 7Cq7#RM1Dbbc8L LI$pbDHFpab"De |IU|ёt%TMbbe$( ɈC8$ 0-T.l3@'oJN~rM7,u:HcH:3'4t:1ϓzA@އ:<,`rNg,rs7  #$Ab.R/P.DI('&$p D@DHc-0EIjdCBdHP&$B@L"f*)0g, -H&&s o 9kl0(A01(es (<{Ӊ1!!0"AY)L 35f΅\l9a Ě8? rę@0I2C,pȻ:v0Q$dDB$d"Tf/Ѻo-<͝?@0%"&lj5.! BB$_w 5*.M=|{ӅT{ /k@]^dB -j~晹QvŇ;'@Sk8("RBD2!0cbU]"rdJ`L@Ɉ BHy蜻rds^ch!" HDLL &ZCwAkL W=H05Dxh<ץr0:{Q|I0uyD"K:z[@Lb})|zǘı#"M$&刘Ȁ @(_,`ʬ̲L0H t^{GWt30ĵPT++bpZXZ UIbb-WPPPPXDC!!!!1)+sn[Q@Ɉ @ @ @ @a @$YXPPPD76qՓe@oFHnZb ،,V,V-œPjMBBbrfLlHnW;;ϧY}oUY枧#=vg{[g`zަ+y8`)flOGy|==752g3,6v:zוrD`$#"`Yf`LfogJ0J-iI@ &kɻ / @ @&$P%A0 ((m9ht<^L,LHLprzܓ?klkl'p %MĂH !$I0λ ~Iw>oQ~@}Ay3mki"B$0@bDL`J$I 3-|ɅyFt\5V\QuRlI $P%JJ@*0c_׃s$pֶKk$ _`$D&L uA!!$LIZf&$6:)><}o(#x=1, fT2x_HLL `LI"c20M0p18_>hHHD$BF3"!"1d1d1d1d1d !"$&s-D]wW:O[r) @,H&H@0P&bIdccsB~6VWlYev|W&9aϙf,`ztg51H,L %]PLfGWpa}6rL !"(( P%P%%/kmN'S.o@?+]䜈DLH2X! f$"B&HHW[ʳXt]pS%vUalŸ}S״jML횕ILg8204wS "H,DH%Ą0Ӱ@/|h։1θ%f9ttG:rQȃsJ9t'B4@oO[rTl.-|X^"qA c"fJ%@FvYϧ@S + ].;@2z+b4]U~Ӂ)IU1$JC9*l"PL$ؔ pͺJlR:,qVg0ΰ@ bKK"KT|ݒq678&n=NxKO_=;uHz=vg#$$GsO=}bzyxj( o҃ v5m]`̣nK -lᯑu΃&ZvV69jE$Ҭa"-op@!#HVWaOɾS-=x6h2Dԍ \f 1tDL`4]]N +!0IRl1"&ZMr d>] J TQߘцF՛:bW65H=K1ek$S4Dz=3o!0H$ ο#8 oãa903r*` Q0Xm57ZCru17'HnFy u47.ѧDS s:"ZpeݯA0Y]?+N>lzUf25(=k6"ޟ ˓$su4"ީnsKlL +$"2ķGyYA~b(/b k]sfWav4kL5 SnCK{>~ ͎am$lPe\MN l'8AQ ?`yGc821-BI"E@,`N!" #rB:h2׊ F)7GL"HL Y]_:/<ͻbYMyQ9WFRaԧmPtZ֑t`ysa_L2 f 9>!n6ڶcF[ZyMHDe)11Ly}>af]Lmrpb62lmjf4]Qf;&m 2',r@Q&c8X\31ײ_wG[&`01@ӤZ )²j1lmՎ9Il¯/"Q7(#ji\Y5uzccѰ8>b6n1"ThIОpG>:^l`cUP!0"`#+۬Ù暻8a W2)e8/MҚfK:Rc3,̙I$Ā&$s=| q3^ s!"%&"& 5l&j2ڌ0IB'Opd0$D@z+_aNE[8L&8n\s㣨uM)@ ڻCt3}9up4ṇbd12 Dlɔf$N sF'Vvk#si\uE9`!@&dL,r-o|{zryd I$1 7z~އiyQ9~w@q0%A LN!0eVPcE| m"-\gQ|+H$HY]>q7V Gdwy}m21wyt1N#,`ߝm1)A_`eyvyyk1Ͱaٻ|eWV붲$DH1u5)rbH3]Y,3='ksV+f)JHm8yr1X Ѩl壉h9â'ByãpW* o]LCY;J79΀dr]u9.'2:5VYςزG[H$ `$@""G ~mhrGoL3f(ær5{g35lgPhaD6y^u8$2s*83՚yzMM7dQFxN9djD5X H0DH 1+Jp^/_5f lvwyL< m ]ooC|ĉ1 H+:=G>t6㙅w`USj[| liƤn Fԍ5#r 85 ji<ۣIWI bI%v@!0 B`YaO~C:<|L3wLz[G+0+5̢cAsLB`23  lj"q*`Wk͵Ɠ+!v'ѫ@#33UZRJF;0iq.p } Pnt N0FnkҎ?cyLti:9Q؛mq ̶)`eN7 $D6Re"`]?7 :TZr{lIZe5euqw_fsXfJ$VH:\=\Zu2V~-_39Ittc#^gJ玃@oƀߞx9tg'E̓Ҏp:NA: 7Pn5$ث9|]sz^ض2&t]YUqAQ__yC];Y"up7+7*tT sۮ6ׂ8Ztila;;~_`|7b"P&K2DU<^u՝8\)WkceG >7Ob/Ho ,ңli6噭WɆ6Te5I~Z{j~RQ8Zlu;5_e-@ b =/h;XNm]Oq1M' 2@2L@ b%  A Ɉ"Ib9eWn`֧8:=Q~/#OǕ\GlpIupz<~3ow8 O9ݼմr<9u8\eob`$D&S16u٘W_YE=̷zNr=US|_r/֮WSw@lpe+JPkۜl`Wex*Fzanfyade̊.PX"+c6@utMz^0`&0&$A I> 'x\qI_R }p $Hc3RBD$Bd  c s3*=SʏTjp00$VWaO.]z=.!n,"boo9eI,ba7aɅ= k+Ȳvr41٨"j #˗kdcDN! H d 0+!KHrBd D!0H&` b H &0pwBxASua z `46 2 6Bp j s 66CRBl p . 4 !1"0234@AP#5`$%B6Ept &ll >PTqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq]'4;3YqlC F??v5 ]yO \;6+Nܴ*J7}&0!n!WJq1obd̨K~+m_4 L1馫 x SFNq#ViE.Tg%aÇT5\SACG.j. >cu4AAfcOIOO^?`ު“oeAqY}UpҶ fUVVEC%SPQ0{lY.ODvF}J&O]'l$Vumm "ĽJq$ vZn$.-; ٢`J~ 5ϕ"J5TGىz2fl]^;anOK;oi9h>O+?TjYUTqԍé1[i1Oت)m_XW*b9嫎m<&& ^T>Ig|y|pch5q/^ݕަ}/<=w~J~u Cb ITKKUS=%`_G1MVWb0IËf:z>/H/OC89j/_Xkv~:V]=s;3=Qw!Ꮦ|r +)["k$qI=$aT:UIW}e$-}LF휜dz֮" UdtqY\:xjt}.l 'YsTS_r~Ѱ_`_VRҳ5ҊY[ѭŹq/V'fkWtqQtd +l3.7@]W\fqhW\fqhW\fqhW\fqhW\fqhW\fqhW\fqhW\fqhW\fqhW\fqhW\fqhTQ~,Hiϓ[Q鴴|2)uv|\U3sΑP|Vs|-ll5՚j ]OV'͉z~642".QQovj6j^]zu׮^]zu׮^]zu׮^]zu׮^]zu׮^]zu׮^]zXmrˆ.\mrˆ.\mrˆ.\mrˆ.\mrˆ.\mrˆ.\mrˆ.\mr|ER5KCT5HM R- R-S* gRRy$g 8aaCzy/W,/oYQ]Ӟ"{49dmfZn#6悒='6%_g0r&tl8_1Ax7ul7^ZC`ʨ"jQ-o>%nHgގ,G]?&ÅRx>m-\Ŧ0tBhqxn%" 6!KNv:dTk⦣`KN55Rd2أc͍^ x2wAm~Z>o+,MÂV8VVcN7uQgcEipTk^+xs {kYV:8Exs.ڲwl`ES*}5 4S fjN[?q9]}D%i*#J%AV=4%O-^O$1pKQ*!VU `0ψCM: l#{sK,pWSXi;>3&ωz)dvhb#0(!5>!"f%W 7"l09cibZxaIωzl=[#zg8]9YYы;--IXߦthkv p1_F%:N=Pi(>Ojƾ^2x1$v|VI7:#0= .?'/o>)$K*eyĤ:X51S*Z ;mD;C4aU罱Q7kib}u,okU-e<.k]rbANM 3>1/W?@>'Q |[f|2 #Ģ⯦ $9mN?4]E{id4cGCQͣÿ񫰨#c颦?ÿQOC2UKME/ޭF%[.$ `o"nz\1ٰn⎎v #yu>0OFRqԜ{I[f5Yp E$մHkjdkFLPRMWE DuRVw衳驠=+1/^zrpvo=/|/UE$2Q5 o熧\dN90ۻY@6!NnʀJ>A`C~9?_ ,z L3ۙұxMpp8IKDm%SGoxřP=+>˟c2sGfdi@p9!?c A/Oݞ|uA~]f#EU&$!cc)Q8b2O )FذDUө%dMlkKfxL{$n񙣨S@ GbU*Zz玏\En)ıIv'[=L\9ʋoEx)1KH, (Љ7EM>85x]up61ӊ V*ˇ:c&i *?쾱Gu`;$o3^ҽØlIWgĽ{O'lnꚞ ǧg~j>7bM xwԯa)xǥB) J0حl5c{{CIO|'?s9 SYcݕnQ7+*) \/vTU28IP7Om] \6d,MxwҢOlE:/8Giq% ]w'y\+7QV Dsrd-MxwIG_7o&O<<1Y sZ6Cu?$CL&锵Q9qXa91r/_gԲL< 'b>frv&,lnVrI# p9SZd# _ub>iVn+in+Vn+V@׶.ƣwqγAC3) Y I 2s,O,+u#O!cKj(2%I"|oG6#$(Mk'/(pP(!CʓaC5?HhMhhs@iq{kC[~h}WO~R&3c$54515SE4BL#)$Ms^6Ľ[f:Z<=TL&uE3t78_dA(~O\ZSB9̝D}y\GQ(ے?!,ݖV(~OG81`2\ɬ .$ i:ww;籍9HYѦ8rmsbXp9Sp!r{欗E:NSE:δSE:NS-E:NSE:NSE:N3C:Nio򘬅cl熬Ëeksokg8s99žbh2M`o?e_%7yu\E.w0c Û&;U5-hkQ9phwD,m[G9ZCm{#0 .cS\KLX\9I졍"N?E 2,MxvKRʸ?4pLd9Jʺ =h}#֑Hz=iZG#֍=iZG#֑Hz=h޴ZG#֑Hz=iZ7#֑Hz=iZG#֍Hz=iZG#֑Hz=iZG#֑Hz=h}#֑Hz=iZG#֍=ii뫪au=q9̪Pbҟ-OmUR䉒52f.507F'KN_]]P ~rL Gd> mDA3d{Ag2ASJK4pLd9=UJ("~*|8-HGY31:]%TF^em#| >6|oJZA*Y؇|^8j6O 42=@5oH(l3S&bCS KbtQe: 70,)iB}<50m ab8[mS<=ᔭb%|5b6+qvZ_<~ч|H;Uiq/bOjy7E]6 ^HW (NG 6h*Q I:L-īs"HR-ԋs*L-RG进 oVS*0wP\Sҷ=f.KO袓wWTdrI lƺN]|ʮbS'˂ibﲿDCmԅ$Lr/O[pkm\lz e?o&͒zU+YT=£SU6;!JqDLIM>Eﲿǘe}J;ɥ5s |v)GkBhOɟܴT䎬Ev]t䵥Άo߭-߭߭߅ ~|վj5o߅ ~~~o߭ߪy32ܓi.Иݴ?(y8" Ig4Q2Nei%fwVɖW )@m?GONr'(dk OerO}<ĢߤU-7o&:G\dnai6tj|w([+{njipn2~[ޟ&:GS9BݏN5e;=8\ߢ]ddWޏ&:GJsw,qWACBtb|w([1R<]z w!!Ї57rk]! ˅ƎǮ*.2NA2."\5p֮Ю 8lk#puZ9֒ui[VEn޲=XG9)EܴsQțI?VCQ#ޖK:aKwq%N?ɟ_>^7c&0s:A%9ȞHcMB69l=|#֘(S~֫sDcZܡe (YB@ ֗Z1sN1: 57>L%Wh[1W9CɓvơQYP.VC>TI$ h9(d-'_W 4AGو;HwXXYXJVei&Z9Uh$Z#=pWppW\<&41T赮{y+ZYڮ?F9 Nr'`ƚ MdI>mP4O ?VG͛>{֖D;lYZ5ej'B ga KmirƯ[S[׭~r9joܷo[[ooo-[[[Zɮ6Q;#Һ $77Xr"~PgRTXqj޵o[-~տj߅ ~oo[[-zr޹oYܳgrVbUʺ?\`@6IﱭtoJl6Dׇ #ߏ҉Nr'dqO af80=ͺ;-FS[1_51iH9TY?4͊Li/{"2o6DS$]cQ;O NqqSg$ޣl}|̚'UC*]XS7l`*g=fY M)Sq8v&WuYE=N254YGو sNTp2$/T:`QQvәK@hVDI=%}n_8yYeVf#*iy5\4>:]*]I?OJe-`h熉%/庽ԝ iQOݩ@ߐ&OY[4~e1Ē'H_NQ@4ԙm1=ǒ8# 6R>~b&=׹߮l}{JDds& Dߒ\eЗ?流ףU1FY l(cD,*hM脖AوyS]\ZQb>'T#%-MppJqYmiMrިUn*ҊrUfWu5Ė!# Q:?VGװZY0vŠrzBή,Od-AٶQNYe,2&&Y>~+2;^XPh{1_Emd5NN ]]E0O6AEQ,uYJ2ɡ̺3%s&kOGو)Ѣ-;̈́"X N !VUeA|UY3;]{~ g]U 6ueeeeV@ W 0Yڳo[-zŽbޱE#r"ʐP Zt~-:$MsJ;Vxսb1oڵ Z@Z+R+R%jJ9jZ-|z޽o^[ǭw,YrUBYηxVxr9gr圬YVbUϝ5ũ)kAGو v8+ɕ [ƭzŽb1o[-|žb߱oط[Zj P-@Zag~G։]ӘʛòI 沃psf#VC95d )YVUeVVVfroe?NQ'Gغ ܠr\}|/وjqrm|M6A@l~襂XZ ma~KPDg<ˊ'{kp7;{8YugO񦜣9Yʧy/d$]6t38<77%PQڄR梎*W90sf##qyvv, nY\ǝukr/9iw2NRbd"}߅?l,fYe]\rUʹW*\s˅ AJctK^Z ZpڑoCy]N3V8>$2 pS&P{1/]K;kQ˦uL5l{pǍku͈t7|O?57YܒWIS=0nԩЇγ-[xV;bUʾ٪ddv)9jItCI\) ˂fى(r97qǛ\U*'_~=S&.̴!9'Xgß)k_X_V_Xu2f lĽzNǾǞVjFW^d;؊GC/\^qz\^qzS[5SvS4KNKNKNKNKNININKNININININININININININININININININININININININ qmtlzD-KqD-KqD-KqD-<+q´<+O ´<+O ´<+O ´4+INtINiZxViZxViZhViZhViB(ݱnطl[-H@-4 M@-, K-, K-, K-, K-%:S2S%:S-:ӭ-:KNKN--:KNKNKNKNKNKNKNKNKNINSiS-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2S-u2ӭe:PLKQD-DKQD-DKQD-DKQD-DIclkQD-DKQD-LKQD-DKQD-DKQD-DKQD-DKQD-DKQD-DKQD-DKQD-LKQB0DKQD-DKQD-DKQD-DKQD-DKl8KR.+D8 \F'F+P+DKQ)Dn#HZuZuZuZuZuZuZuZuZuZuZuZuZuZuk Zk ZbTw\VqZ%Ũ\VM 4sج[U ̸|A2̴3G:N,M2L-9}\6ݣk|1&O9ȔNֵSuۙ7ۦQBZچ*'u) 3O)7w"*yVCШݾJ܍R􎻐kր|/Sr**z$ '89=+{~t="Us2f{jofHЪe q֢"n Y@] ,nyg|Q`7aAdz?g!0ؘ,9er-<'NIl-FPf̤JMT?w8d_Qe RJ".DQ;Z D0sR;M{6u֕L~}< 7e~Y?:s&pn)xv9<eȇPDYSZ6*kf ⳴Tlgjްm&˺}^05>TDQТ8%ڛcdYz"6kZ< %YºE3$uxenw?.M(F,b[Rr6%٤+S*JmijcrcN4] Sɴ 4)5;v[%3T nׄ ()-2ZGn$M}%755ďGN56K ˢދr%_j()ڛ؏wW 7+!$6l29@"~8twϺlZd6n`̊Fm`ږ1:lEs1yZa6J9g.q P%NE)B\ FB؅[ȦvW1Wn DwYm*eLJu6uM inu%܄rg&3&Hr րJ*tEȔO( 8g_k YpA{Vdo 4oWh ݫ-;Q-^;D6乤ۮ:Y;nr#L =&SZi8C>cs'"<#e`״lMzrgtEu9WÓsEIx '="Q*@Lb+17 ' ˨31іTe4, = ʅjffWP "Œ[u(Ve(:7s7,S[c[s"eK /<tW8U'HJU9\m<ۧ3gF)d*ȕtJ%u#ّL{=/'zIa7V] d"NK#_JW# !R9Cxl4J+=ߙN3;-Lp]#?J~R˾,)<LF\gG1^X)S!b0CΦvb}k.N s78=9"Q(~P[g +!vš Y y7@V:ou*(_%PPQo>Wo MA^z?oVe['A#VW++-ۊ= t"eYVUdF4ms&,}a=Ҧvb^z.IZ"ʺ꺫if]Hcȷn Y꒘~= _f'xdw1y!]nJld);[T֢++*2c@9CZoȎ,td]&3'S^ZL+ eЫsg&YȻ~q ȵ YVUeYVUeYVTXSJg4 μH T[ҳ/VPhE%Ѭ"ݭܕ[[[[ t!nVnlm)[$?a'mN%Y3x@)uMMi$+rKEekr=Պ(VB)]eLƽ63))eeeeeeeeeeYVU)a_+&LyC>7쮋:[@Vnn-ݭȲ*Ȳ"ȌhƟ-Yy}zb \ƙd`E.f7=t)Zȅ8Kfc R05(X#k+lo:fdZd̃i;<:G8SZ*,S P pR:ʌޣf( (l}]+m-jsz<\mK+,P+\X56ɍ̲J':駣2̚z~3]gr7m]ir~H[-C$loCp@YB3Pп쬭*s.6k.Ĵt B{W6 .b]nIGNo8L)\!d(s!&Ӽ63)`\:ɪR,4BA3Ჴ9@B"dhf!: lpE]+Y1^ʕ_۷%j=>nAcz`M sﶇى#B|Ʌ$Eff_-x췷!Y*ߋB@VoZoV-[Є+0E zŝh/IN1H!7$c q؈F+erd, qgR4.7OK]E!HݟI$Tj̀3] B+Dl̻JwA3#9_7*I[޵oZoZ[зoBj5of \+edÔ r|#f)om#ʣ~| \ uN`$ϔ?3C&/0ܹxx۹^ֽH9sD`H>G ̔+3sJa {ϙB2,AV%=pՐ$a5[B`{gTo(̋A*oE3e8R;V(𺫐C!9rmŽD́F)$s#۪ Ȼl" Ic{e8 %+wBʹYVro[ҷoVoB.czun*@, tzckf:!I i:TV;1W| h[1NUdBJ _6) ^dnʇUeW'a嘢z];%Q# $K]cT`ճ*LaqrhY|%Ⱥwu!e\PF׸T2Qkeh*J*)5 -׫ٍ_(ۉiRL\)(j7\F&q԰ə,C.(J.,vf )RǓc^il<dԧIdc䍮/2ogi{\$n=/2躆kĖlrxpB5g]w6YQ`]+%2%]7eܺtz!. M;an)Zkq**LOPaskt{~ y*Hê AV[\>KO#fڷewnrPh̭XҟF׹Ѱ"$B5  (YBܲ& ) S)樏A:N:NZ9u ڗl%klН!(^Sڜst (FrȈ%[agY]@m+dV[ ۬VGcS:zjjAV`ZIkb Ƨ8f0cU k7Й}HL}ݼB{\o,'\țc.t*"t̮f{+lYWTR.]WS(\' ۫] +FVS#;det;ǾM~vXVU]YQ6l 7}R+}R+}R+}Rt /ZZÕAݬٌ},5cdMۘn[dFG &rQE5veee~l`',Ȯ3]wA5R4,] nrqƪ;y j).y؎AIlgyR{LLXMBrj7w}JT6A;`)]gCgEbٛ+!1A 2`"@BQqP0p?,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,X?TxAAAAAAAAAAAAAA $in3>'ǟ1-{Ǐ~؄ܓ3O~MEl=?)ݍɗ vW잲=h&&Mx'VnMf GД0uէ*tNvcP,cǵ쵌%#}-1].8fJ4Q`!D%lntJL\Z˪}1e_DZV=5J7csTj2rǵSp5|GR nu[|~|0xbj5NZyt=?n|>^ u kSj?N8[x-ϋsp88u"#P!@01A` p? 0` 0` 0` 0d 0` 0` 0` 0`t}z6}R******************************;cبTTTTTTTTTTTTTTTTTTTTTTTTTTTTT7ۈ|L'(>.aj!B!B!JR)JRFWS)}?j]K)uw]t~5'OǾu7y x |矀?ƿ}}s\/Ɵ/ǯij$!d! !2BHB!C$L !13 24AQq"0@PaBRr#`bsC$Scp?|coȴ|'hO"Eȴ|'hO֏mhO" Z>?Z>ȴ|'kGy- Z>ȴ|'hO"E?Z>ȴ|'hO"Eȴ|'hO"Eȴ|'hO"Eȴ|'hO֏- Z>ȴ|'hO"Eȴ|'hO"Eȴ|'hO֏- Z>ȴ|'hO" Z>ȴ|'hO" Z>ȴ|'hO"Eȴ|'1v2pqcE"mXU(jNֽ$S^6L&Eo(O6Gax'84m*#1`8WΈ؃O> qJv4. BTI0]/tZ(@w!Dn,7ODm}dȌʌb'Ep$7bsǴMDִRp.z8x,W¢DiIts9-8JOV9Tƈ:G8Nړ hMڰ@o*#axjll!苤aģz~| PQ nhN{lt]nSLcYN+ZӲ[Lfӷ%m8 :S8LnM9Έd(퓛L6gax DS]GkLhF0 fWrk 0aotQ0}W¦ѐTcFk QzGPC}+Rte=jQ@p8 q]0hx oZ.<YNt;vMfYyl^E/¿ʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʿʪ9UyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyUtl^EfYyl^EfYyl^EfYyl^EfYyl^EfX3!$f)m-ȑ Ʒpql%j v"j-=SNw !թ Hg1i ZC~~~~||z՞UUTOwy؀V@AsA4ڡC[eϳb7xowx~昅t4VAUL |Gk*F[.Y)d 3?slk! y7ujkvD=wwH nvvшu$y-w *%3ECRnŅEttē= [iCps Y/HC #C3iT3V\Ċ#<84Q$.lr~:т J):5iWG [_khW^<'=1xq:5Qu_|w^Js@T+)dvrR7dg&zyJϱt":,yݦ{0[7erg.+H'_Wx+< _Wx+< _Wx+< >/I DlFahLTWx+< _Wx+< _Wx+< _Wx+< k-!Hg"ȴr!LUr-!Hg"Ȩ@ؤZCjl8'ge2dCta>hR"aHvFm7lݖ<#wIu{S1?0e  cCZ5vشL5 h;hgDzP؞n o'%OLSWv)^ĨyyeFmo(`N`u_ 8ItOςh޵JMeQ\X9Ptϕ@L] M s{&GHH6{(Qj0ةxsvc4P4NzނGZ{iA*4& }fXsl"y/guY)t3 d=hs2F~0x ˒O{K'C V DD#4ܿ&0Mԫ_}Ɩ6BRL4Db:qᓚ*[=C4ł i[`޿`ٸk ÉRji߄Mϊh6$;/l(r?T)DV{ߌ{vq{;0@xwX{G-(ҦS-tL%-`c7*Iԁ,1l;j,xX?LȣQ!FUQ?O ShDVA&5 6x⁅tu2~hֆ4c?麢SC8 '(17z{0[/SN#[`p蟲!_άwXZJ)v &TeZ$#6IgPwKZc-%#5VWHmiq e9[ʤޕkᒂ݌7v4Qj9AO5LD `AVA0YM<:'IsBx」سwd{/O+ ;UۏcŃdC4oqFbL {obnFn00h{5/٨{"ނ]([z+TɐQ(>so[[ͧ`{}^+vv  Bi1!8I=[(^\fXQp4w=|d@}#)RX?FE`[$:ҿ 0l." 5'lMHTl#H'|h%cк 5NbFzt(6q3 $1W *N)p>hw݊&^+D1Z1j  غ`ցѨ(CQ]֝/۩ʋ~ś27}۲;Rx7kU7Zl f|v9KzaUuS`.bݤGd7} ݱN%~Z[_R[o[gj5{JF'fr*v'v=wgq 1 < #2 U6(qXU'8*3WEc7SmFu 讆؅ң.eABAB;[Ik)0Gc qMFU|aFٽbJAc:1v(7Z Ճ>T:(5, uba뵇/ oK!9ڔ8PjD.PpUՃ\D|,Z^϶(q! {&V7`IƓUS6R eRvq+?'\UZ,SUlٱL)J%_Wv? m` yn 9Z|2z(  Q{EAL!lg|3k\p0[.%F[acTf"67/`itU&!>$ºأ8VVE06$> 6$# 6]iQ I(buBFBjbr*mgF2TY'QޙLSs Qބ!j1jD"Qi2:f {0GHU[ZT[[E;\m9s[g%ܿ=Ey]&.ڤ$#Qh)btk#k{b.qq2'$v2@v^uK`*.ݫ+).=NV] 2ݧaaj 7[TřR+nja,π^^&1WmHlfwXb,He7~k7~k7~k7~k7~k7GY5Y5Y58ߚf+7GT*imHdJӰ/$ڛB̹󍽁#'e}FwaISs;hRWaQp'A=_6.qEeD3㙱uzڪ63i{xM*)nUu+꫆D93@ #m3@Rr#ʛv.(7gbݍ/dmNVìv Q9k~fp\ډ=]}V֤ 'ۨlj6)v,n>T ;55v?ggbfclB+=FG̪8$E>NE:<&3GsOZfδ#iG:0uaL9֙s3ZfΧ^̴#iG:0uaL9֙s3Zfδ#ixG:0uaL9֙s3Zfδ#iG:0uL9֙s3Zfδ#iG:0uaL9֗s3Zfδ#iG:0uaL9֙s3Z^δ#iG:0uaL9֙s3Zfδ#O#iG:0uaL9֙s3Zfδ#iG:xD%aL9~ 8X*Xf[k}_M++0vmunT9џ6TΧ*.&ؕ}h* OjjSIè/`u$oS00{Xf[k}_M++0vmunT9џUm8 RcbC0b`hrYF=O:UsLPɴx=6TΧ*.&ؕ}ۥ`* OjjSٰ XKE%!c)jd>χPH- D)ɑ!/lMC:}Ms03ޖ'Zfs<${D֠Fk"k:+M O]T/n 禼ۭELp΢T=<&TXQH2{^Siqqρާa`[Tì*Pb5Q/uL;6*q1eVv*] >AD$bJudTp-Bd kZER6Vapƒn4_):d*_fC'D yvjaoSleJ8KqIcH)L)UH HhکLxLx&qյK :œ~﹔Kee}ͮʜg:3ʕtpyEeQ )M_p7ulx&~V,3-p pb5Q/uL;6*qg *UYS J~&0Cփ L֙3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgдϡiB>} L-3ZgФ&a`n2#[*z?=m~oG7ǣ[~`_-/߿o |z?<"Hb@+                                                               4XEK?\ <, ,¼ <, + , +ூ +ூ +ூ +ூ +ூ +ூ +ூ +ூ +ூ +ூ"å, =gxY^xxYgxW^xxYgxYgxW^xW^xW^xW^xW^xW^xWL=g,圳rY6zW^zW^zW^zW^zW^zW_|W_|W^zW^zW^|W^|W^|W_|W_|W_TA 3Aƣ0X8"5oxKXk5x]ٹm:eSd5m"ZE>% P6c e:ʡe:'YXoTZn܄1d1Q~{x⣪ Cmn7#èoOb{xIͬ(xS, Oq ]!͇:8mdlԨ |-B+TG*/?tb# t/#۳|_ &Gݍ$bDv%@lN^'WIoCj1 4~05Jtv`$Ԩ'Kh->*wrnPoNܧvvXn W%TQT/g_ʮʮʮf;wv UNUrUt '* 1c,pQ&/6E HZF'n|+ؙ4CcU #v=1 꽩{ :BXm1V8.6] R< a#i!-~#~~~{( ]Gqsjs-q5Ao owZ zoX"nbFa:0(j&75m&ҡ7a}d1=ҫ637(3#hMqkwWھ~B)>=OA6>Dg݊];@ӭR{ˍDԧ7wjh8EmNڪUMd. T @Hx#7&mrm c\!s2TCEM9/=O8T\^II|X Jm#6+bXV+z,V+bXV+Սɯ*>{( ^m+kW;7wnr'|tcfE띚Xv6w/T؃q#DO΋ʜWzECU+wr+u|Q>rڤюʷh&'|tXJc? Vv6nCaD &45g^!jx\UqV+WkVsVxW%\CgZqU=ʨ%We]tv ۸,pYa^(V֨ vlDOCR%&4 }cR˩]4vFFZhyOf|'ɵHITpRC졻7wakOIݪI:חhҼǀ7w#ZTx+]f 0³jjZYgkVsVpY^|gOrDʥ"SY8+|.B"M cf{ fY>&4VVaVU-KR+XV+bXV+bXY5f2VnDvo;7w)eڭVXV+bYjZVUj*'{yE2$1WbZԨtSm EBg}▣ݍ&܎M/M⪷nEk_ 'OWݻ7w T$rd>jFEV,*=IuVgmڪ^}?g5HY&䜊W7vhS}el]^EKb|'jj2RAٻRjU~ =7ٳ&WQcfH)6ܲ<2'{Q괪YUV]7vTZ]gʟDOpv =UXFl׊]O Z v6nUv5O{~+v6njȯ*gOtճ]7vdW>VUjZVU_aQ]j]ڑhٻVYUj[¬*¬V,՚Ub-KVE՜rVUܘ +2-VUjZUZU[QcfZ"|'}{ud гjZVUn=j¬*bXV+b}Zwu"'|Z_7xoz/ݍ~'|dn?_K,؃&`DkZwфp h9 5diVge>%!2|)ȳc#׿W i\GK [owJ3En 8H0n|0[;N,N:C ִDݍF$6j>&l6N:)T8[}S)vt:h#H 3Iv*-D&U^9uTg-{qOa: M6R!b dS @$1"3HW`Ašfh hux+?!s*P FpBMA?o䰏~(n#D0g9R&o;'%Aq;SWa`;_| O=H19ˈPE|e`E<#)XXGێvU02$$ pD5ZA"Aº(R9V ՠ *(BFL{e6Y4莔ݱEݍDG"g[UyOT'ҥ0aS֧iڟmKhV ]F6smhD@ R9^sF#f@ c|̧- G"Ty^SkE=AKKAX38motSxqeR'PRH贇r!ܫHw*a/Wb*#;iO#8ݎɐU;iT25R8[e***:j]fQɉw [ j ;k,pYzc({88{Jװ ({q{Za Iwp Ip I IwŦV86n+ei/?_ I N#ɉlVJmڬd.!p?Y *\Yġ gPwpW,Y\gr 8+rpW,YʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮYʮa|*g*g*g*ʮar|*ʮa|*ʮ!|*ʮ!|*ʺYWm]ov x+Wm]ov x+Wm]gt x+WMங]7ot 8+|*ʮY]3gt 8+pWLங]3gt 8+pWLங]3gSfhYf1ȫpWLங]3gr 8+pW,Y\gr 8+pW,Y\gr 圪*ʮ!rrpW,Y\gr 8+pW,Y\gr 8+pW,Y\gr 9U8+pW,YʮY\\\U  W^zW^zW^zW^zW^zW^zW^zW^zW^zW^xY=gzY9g,垳rY9IXgzY=gzY=gzY=gzY=gzY=grY=gzY=g̫_ pWゾWÂ~8+_I;W^xW^xW^xW^xW^xW^xW^+ ^xDc______ 'SQds(=g+1۸+~k^qY5Y]vUەەWn]]]vVbԭ 9g*Uت62خ3s!j,;*:ӵZnv'%M93T^a3(MllD;N\W2CeJT`JU&8|״]ݷڻv: W"3k´sh҈3[EM0]wBT6(0J RpM ?iv:+v}{nTVdӏY_8fYS s-P7252&P| GUR+A[ (_R;\~inOܡi짱DُU|'|kP=I 3ꐉ؛sCxH?Dfj]5DӢ[̆ߪ5EU(osvءG[Q\9:W[G C}?I7LlMXfflA/񍐶*#6ڌ>m݉ u2MtvSȪݽ6b~WgJR)r^'`{"g4&"+4Ұ Sn?Ll)*Uc7)T)jnQ>9-p8.vҦ"Mējosԭ=uWgbɑRnOOkV) uc'i6Ƭl7)ͻ?**٣Xtxn;&]]ʥSvKwbV+{W^E˥,UjZVUouYj[˲gM)g)DN:%,m4NT6$R*C7vvEj m=DN)IW1J^㶥VM I%HBiYCRAVX<.v!Hev'%VRgbYRx#;֭UU-D|^JT۷.{ PU:Mp]b?J'%'NWYm [ۻZk5Mݠg*)2l3T>eMĕPʑudV u+ D\UOUf99H t1<]b؟𜚇b֩x'Vj!읿uhV0lꃊSVԀ&G&ujFEgUlYUFzW"Ud-z2*QY9 VS1ZT(ΥQUû7v( UvJ᜵rU+1K&栺Tv+bU3j3*nSGV)TbjN'Yjˣդn@ȏ%ao4[ 1uɚ*g;T?TrMī~kyARMRp]!rٽ Uչm JJEJ%Wi>ͻ?*ܪ[f-*jjcRMLv d+2-U~h|8uUn=ҵ^L ݉n.x.ˡyܧ%^L=ӵNNnKOW'oqֱV+qCX[8^)Mv'%TUTr-C,Vϲx)HUuZUt,\rhڭ[R X4mt K*B4 v'8{:–/5ѿ;ʖM&ڧ,Uk[Tc"T+H))>5RMLkm^dOLpUJU*bl8Mh˙&gsnON+2V)Vֳ_c?kPE֪ʫF$pNT'o2VՋ_oJ]Cn'iD/\VyU⨦w:9ⲵ_aA/N؟3jTy3+V+1TU Gʛocmh8V'okbK9kV-]ԅ2NvGt.O;.+5V2[)K*X䦤mʤx=mR˩MIV.sZ*-IV&dML*m֪8gjDFFioTLHJn-KRXhV+X5fbfb4.jm݉*yܻUJ@cww1^7Vq[)vUԦ+NM.ŭZonu)y)M7e?\AVԵqM[fhGv'bMeK.jSD{M}:i*2NغXVjY=a4?U:KXKتjr<*n؟XU[̛qW$8*m*jxh2Mē+,ݿXVvbTUz޷1S]jɖ+[bY].-݉۱R%TʬdWtn=ʄ;u) n'oZ{8sd>aKVA5)wv?nUʱMurTEVb#'iɤ:UdבMҜ՝K%!jʳ W곛N)*JEfJa̛Un*6[Pqe#4_Z,{hZ6k=MPD=wbU**TUUK!W[*;;rl925lLvVUթIصZw[(b ~)~(.sDFA(Ůh:9le)֨ΓݣWFhTn]JT욫4f*@/iT%1bYeVٯiα4ѢF#B.PPD8<^(p6A m-vFP@:),6QbG9ȇZ17v( QVbTqUkЩ0ۑ9*Q*RgUudK.A.2 alm'0/m2#C_T9w ]'@e{ݪj[bXUdV'[ګ|k["JiV:neXkEa' XLA ԭ8>2ֶ)eHIڡ2jj^+q=u'HY^ʊ~$(TL7|9ߡXV(_e&8T[jMVU-UFN.R`g*܊-~ Iak lXdD9O]H퓅@E~ %;\2hUHM3Q?7GmVqm3=.3-{\޳]!Cl76Aآ5Cp,TGL.`m*[^j+5`@:#v)fUJ(ͅ4#jH[XJՙ3*xIeuvn5 .g9*q3`ZdVCdgoB%&Ӥ]RH!!%Rm Tk؟]JJ2AX4iP~6 @OHϒ&HNV$N p#% !dAz$; #f\hʇPֆaBfC?/^yfeoiK FaQ.AOfSԸ%(Qcs[.u2KBG)Cwl?|9D+7N*[V*HPjQ7+$:7e"(MD#{uX1 WU$$O "6ɏ7Kȋ3?!KD VQ[/`ޕX[5&KuXS/b! LnkU(?$mJpMGBQE;eQ(BIBK%X7?@(o5 jFT#JP6)*ԋ;.hbzG΄ƴ4'[g\a݄*2@ݶjKJ 0 a<ɐ%Jw L:t//EDRs&(e}Q.x1t5sѩ)%5m5#Er:r @2\hl9 oۆ^SjBN,,08PT&ELNpX,Fe4j3 XPUou'r6c֖DAJjɿ\^)B14ɨl3*BF$2)"A!JbeXeƨtۘܓȚ dH?)Fv|?E~/_|?E~/_|?E~/_|?E~/_|?E~/_|?E~kG ^DVܠ\I"]Zênx{zd"JBCa9+F{ J$#e)^Y Ų;#<=C@P!hZ"!hZ" DB!hZ"!hZ" DBЅ!hZ"!hBD- DB!hZ"!hB- DBD-Z (?W24^K2Ke$ }&5x.) G1RGlO ^g gtaih9J(yS t-sHIw{w{w{w{w{w{wl(!RwI'twI'twI'twI'twI'twI'twI'twIup'OO3? a? / "y[;af쫟 d]aC1fQ1 BIY/Rg \s*lȡNBl XwЁ<29 JB-Ȼ9 ]8=SQDFUeI2<ǢVk_痀{tߩH!'h,TBd%B| 3G%D|Ր⎙@**1ffhKv)dr=OUZV`#*p4OīqGzs /dOA=ZgU&t/e=#qf!&Wd=(ДAxGQBKE2)+s-K/eʖg&UOamGLAZ nQޢҙܱuW /b˒'_⪳#NUQ R.: -,Z͚^XBCd "FfV5/R@ݦ1?ɦ~oI?G:$(WD:%̋eD%1X۔{Datr<lyգ"i,)D45ܔ^s7b?Z-@G]QD)֘j,!5]ZA^XL"_ph^~HLԔX#e O,/oQ Ԩ?6᱆jM'ۘEMID,WDYw/Rټ ݡ&NʒBؑu ¼TTJkf&{  Q)C*]AfL"3BBsDQd62=c2QC`*3"¸+dD(DJGn8LNdU\XDn.|IgAHh.:GRt(!I(&Y ͍Y Jُ$†UMZa BIY!eWU&:5ֿ͸Byv!EX- wsS}B>EBn[2m)5J(CȈbu(j,-) &=IMhzN q6D"T9 G{~-0-3!ͤr/?"4=k!νʈR֓yFzyz.ۊ{ojM}D2d9Zp! |(E{ UjUvK⯛$Y ?kys}uǠ^OrF[eٍ&E:~̛̮_D9~N<^+UNV(M )]ة$ȩW+Ú|(u!\nE' ]4^Z[oyb͋K#r)ƖOLTRZ|"SCn3nHXFבe y!x] 9)H/ 34PH:u+&fRzg)=Cc*?Nȴ%x*2EgKjmr(%^ffߙ5o ::zId֨r-gviҺNum:_ŵ:ٴ5R"5onQD=WRgd$>Zs#!d1QVuߛte|]`m- 4InOB)O:LԢ1F4Y $;3]ETxfzB3ufdR#!k29TEMM?^ޢKd9/WG_NfRh9Re0ۏ~;q4b%;KMS쩒iQÜ=oKH1@)yϚjEgqEK^d잪%q2B/)Le112D]1#U9%' إiT/,H!cGBēeoW3a7DEZ&ۯ{mOS B Q.?0/ׁY6rk7ZeY-gԄɚɒvX\kHRC9 u} +7+UɖyImNNcRj Im0k: @t z A^5:Ck$Co*]Bہ͵ż-ݗ@e,4얬{MFfPM*8 y*<J~vrFL\씛%!f[;BW,X]\ԪHWEin͜WDP/meY{xcYȺPxn! U>O'\;64ԧ=;rb*$yi MfE"JY,:DdD^a!8qx6j P^)Z$x3R􆋡!؈;+s+0Ԁ=ҍ+{a\2fC|\Ǣ^N[\% W#ͼ[38`i_mҲ#U5ds;I$$Y/c(-\FBeZStݧ"2TB6eI$ZrVSIΣXC*;+JOX(=E]A$3d4[#G NqNȟ!7\7v Q$RQ?JuR}y`=Ed#qϯ$y3zce!V=zD2֦3I7CBLhe,B6$>Ӻ $"BZ%O_ úIBD!$$u(.$@k,`Dr,#AނI!$ĄlGb~ 9_۞]y 7hG!~tG) Ek'hwHI%wHْ)l+=I)=Jb,oI>ޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ{oz~Oٽ7?fޟ;HPGlu1=<ǢOc?z'yD1'b||}=}}}}}}}}}}}}}}}}}}}}}}}}}}}312_߹3rwg|}ȟLkATI)L|Uۙ r~~vgݙL&6cmʄKghgkgbgbgbgcgcgcgbgbgbgcgbgogggggogogogogogogcgegcgkgigagagigagcgggggogggggcgcgggagcgggcgagagggcgagcgagagagagigigigigigibyrx*kY_'iT'N)SRTz/>8&.9PKܬaC\OxoE ~6m%d7,jVLJDh셤6m}Pbc'ʌ+J9Ϡ|S/6RRM4|E˄vD.%=Wh)71UGUTBɟX/f6D%&^S 7\ t,(*'-A;ל>ގuo)3Q;",+,$IgW116_R0rsjX)M8]q1TI CDixȗ[UR'Fg O,t(_jb_N|,cKEOnxC 3!##@ Ѳͦm m3mpDY'zoH#~btB>eh *v&<X/ ax'%ş]g/ lo=w1cCa)Ep0$=XSCB(B A #1[Ӊ</x9~ (cGOaB\.Ą[\f* +XQpˉ[do_'LonxQv[Tߺȫ%pkZ/X.6tJn$P`\>V7.%1&@C|iQ pJ)ks^ M^ĭiDŽ< ZA7 >P+%2#c0 ,efU: uğ 8-IX}|QON2HIHktV +4曍U,]Y:b|/΂g??Iu $I.A1|R! m`J]4^,'`%8 p_(Rb$xO$DqDPAA#lkM7<YBid*5%/^8kF88SDG6eXW!iIgĒpKOLpQn#bjN((.&HUmf+iN $I$OᆙHJ/H, =G9 x_ܞ,rž Kʋ/J [8e^?[L!a(xAAN)'Ǝ-SȦLlX.e[>)qAbPXp&%Nbl E#Eq%-Qw$z}BS# c@k3k I B x-8kI*,YJ3!'l< $'Ǐ,Y!|Ȉ  n_;tPOׅxr#/eb "B65- t;QvcaЅ>'NiF*p0X@̸҉"o!p:Ր%%Xk$m#cFR]6Пy8#{Gq'pvLg1/oxI"FػFqUcKC2 d0@–papoH6ѰA9&_vo7̖Ve7!%$XC'CV!FKbIJ6CqP&'ى2꼅fsӅe=-JIH-*&UeeJ Gqd!k7"@."hsUl?O8S="lw~BEX#W y栞%Hyf۷\âb\,!-J{'O o 0 &ao\X/OR<^RWZ!8B &OC\i J"X"IPt,H%Uu-/~n1dc(F2?]&2ajGkqpR҂"aAi.o / Г~]sP]]4$zqZ+*IN+m$#ItCI#gjthvE|DI~t3lO.$69U Jk sO#9 hB Epu.UdFGPV"7Ƶ<~/{D I"DAh$IU%fIOFTUdLԨbb"1{4-=DӪǃ#*GEp7Wi#@j0Z}CT’3daxNc.(BX^llx?B,XHATL_sVS"9cq^E GԱxRbEOcKr$lb#AJGB'3bi^[XC/O}!լw] FªIZH.> PLOs*M&S:a8@xPF2.\>RlB\Ʌm#JI`bdydgzk(XncBO&l F$% osadxiҌ~ajL5aFM4)z!+oԸQ.;Z @60㕓! :.,!xm<$."BJc\5o0## _{xN/RR1 #}.> VZTTVOw QF!vb8Hǃ^PG֙ ,YS&plt3<> Eky hk':RBBqatA`! g~OU1lQ!`U^. 4eq92ְcZVG F bFV<+B%EK[~ p7|Dp$y3bm͙6[[h(#BĖ[qg EE'`f/*N a AX)CFnHk?KٛL3lKt7Cyt § RLMS}Ւ?[ObDধ0+, h67WLcݛ~oMގwcΤY$I$8\3D Cm.C!l EQ#7hjV\(AFAH|d$ 豇i0G # cc>&Y"diN #W7; m<a7 tћroٺ7&r-j!1/*Nr3$I'N2N2Jԕ+\ 8cLi <*CƸC AA*gIbG 1q7^ ^V7[ Z1$HCI 1>q?SQʌIԱiF4?IqABk+Kزd)7,N8T7DL|Q`EM#* ~0y lz4< |Z7Cu$,'SUGL=|,1 YǀҞ# R0S58KsUE1̛' ;Ƌ~O8<8DF6%j*@7X!dKG(a)ҁ 8 ] s! z :QkRZV 5V犢KIȬzmQDazYR­jIdTe5DG8 t?1y!ۺN 3s~dHa43!eF=Gح+C^E*į; +f:lZVX~_/8DDRmo3&l-QN:ɼP=D R;Ӛμ%U#E1S;#KF Gi /-w|+Oh8%|?)wGq}H33333333333333333333333332 3mћ.tgdfˣ;#,HCR#>|?ywwړV: f$FMɉ 1 Z@8\ To:R vC@jQFwfPY-~f:2^z<JcjG _>aHh/.d,` I&óȩFJj@d&H988@^2&x8ʜ7)|++`Jc$ؘPf n\ZkK6'Ѓd (}ny3)*5nɼ?3b^hHY %Y:9*>@Q1K|M|QiPJ׏XA :^%8m̿qq6 wvp ;~Eo%[2A|=C2|yh8sq_L].3^ w, ܨ-0ğu9 ƩBh39#$l8m%.?+jlWѻJfVKfBwͧ,GiBPF/u7I?0tv7nd_<.\bkɖ[9q06懦a;D2&Jlu$WYv3+mlϤ~# N[.$2SR.BҬj73:X/q|dDў?\ }dNjXs+N~?a>UvS)ZST$K/ah=BTF+(,Vڼ1B3r\rfkDQXɟn1A& & @Te#R<{V]H"L՚\[oIuMEYϹf^n$!}O/4H#/qbv*?tm/dhU T-El=f\+FlO>#>).2--咓}t=Ѓ* NR/6[ ҘhtWM$d(D=Vm`يZo@:,"s3X+g22dيfdVΔ9)AT*<;zX.ƨ`4LHQH,Hc53¢*:XZ%[0 QƼ2VBC0)$U*(X%4Es/r/QzxPbqL1 d\DfFPRɖpU % I'pIp0z4f IЎ,j&UB$j2m|BE a>d˓BnI![a~>qLFq$5GT0]N M2C8S ˅Sk8[`,fTѕeAVPpE+?xdHr7w[BL4 ~=\49΄ rH*ۣjȋc<;a(jH$Ɯ_%Y0Wm{fM6e2\^_x 4,@FFC\6%ʼnnXqn3# Ix2دZXЩ uX,&(%X/SGx3O $-'~j a,.5! WbpkgMV2)g*Nz0, }`,^7(Pȕ->B{JP]Q" 5$|\x`_\)67 |RHF5T#+u0M 8ؔ`K'Du+#L A炾^Rq'4Ы7V ԊJU($ta)ݠ$FUf\[(Z6VYm͓ [mV`iu'T+ C)FkRZi5 F򨈭L3"4{V٪>? #|9©mFLIxbHA!bp?BXaRg DZ`Xe1TTƑB)L/R^7+pr"xTY*v*rJPJ$1]8J*!.Rlw+tBݎ@NS1in( *MyIQ 8:n3,4R6j-+wJܠ%$ XŒy;s9WRFQ9#HVciw;8Mnĩ@sIm($g 63*#peXTx2?B͒LfMELJ%J"h8W!̒;oh`b (Au)Wtmˋ2qV7fz$ln 80yw!؆f2oIC D'ilH5@lÓjRD) Q%!F|KOp,ɔjo2:JU΃ "xsrjb4L!D*` PP?! C[6l) QSD &5E͒+.Ɩ刀 EZCnJnZɡEI92@Hk1 y711iyA{čY"v6P_aefes;A6Ouv"/kf2c S*PH4*"fv:i$ʌR$(E3 ̌6¤o`4!K n3cj$ZHD\u^l<(#GU<+uzlgS+!!$Q#Tbd!eǬxN3pPlf#D49;(SPט÷h1EtױpӰLDt<(҉EVd2S:K"Xk&E¶OlM(d%'c"leg$-Mf[3v*HSlG$YAHb%J&2xB.:$fPH$rDTjIQU' k0ZdU[6Iȡx*N.&O̫[@"EXHi66H@Zxhi:2|% d*46t>`TL!5{jxAM44GD#l/^DZ- b,Aն-\ 3gP$: )rFeA4T=sc&5b:-Der!6t (q} TБxy†ցmt8'eH覣9soADEv;I"]ȹvFIthkEFn 3ãw-?9kqUHF:Kqbs]/Fu#ʘч),z32ʤ XWD (_=P7011-s7pXa۰#/L42!LC*L6@bC0%cBņדt5#*Gg XttPAt"l yhhttjwT92An)I܊vuȝF$I5[ ,w&dV|i[܌[ԫ*!B)yMإX SKMS)(.ԏȦɫROFI־U?:UH$D7fr'[o&%4 x%N(-E+Ԭ2*'*B3 DINe+bg39ur%@aGg.Cy] ut/naB+ ; Ϟ6@I灸oofRVCRS0M ;oA P%팋S6"Y#gb64TbLL)Bej?/mљ=3I)- .T!A̐!6D=G|wXrcBM%9IT֊Z nJ3%x͑@0jhImQӅR~n&h%jz[!wUԳ&Dc] {6 P*M-[niVjHqydH舕S B  "oQ2rPA9PBe DV'|)I Ez$BȪ$FWaૂg,*(=WتlvE q9-J)Phzp7NNZSUک0 IZ I]M6hd<3PJ)udU=mKpӣiV\[Ped:\ f)k1',MH4$_:Bd4塚dDwPT HϨ4Fخ)H[;.%,qtu NJeK["_M44GM)(X{xYcl,q,J0NNNO!L4)⼪]"&CmFPœ$L wrS0U&:F)WkbVL;F|_6˃2Tؙ*(A ACblAdDB@ BrƂI9;{B*0FZ-QЩ,$ INz󔣿;Õ?^RkluP !`i[)Ts4`!C.*g?95Y _h:F ` \۲HL#iɡ 4q3AIl&:eʖo8ɛl2 %)+0gI X] x}Lya3eUCq Z8bPՈ8|:m'x 44(=X^\#T;A<1I&]5A%[Z,f0%H^??8naeFDsOQjP"gFA2&F.Z<1ˠ$-%*^›J3#s_~u !P׆/PDd7P)d8(Cl *E5DX9B汃PZDş |b<2)Hyl]L$Q㞰 ie 1A}݀\A FFJͪˌTrŌdD;SšU7QΞ@>'g|O$w9$$X%J 7!P'!9UXu!}-$7A!! xiC )c11#TS\VReIMzJNˆ7=#o&T"焘rtH%jlI`H.KtI'(6rXnuߍ}`<@6z#v)5A\ЩX 9Q&P9u.q҆)iY$7-3$BHR+Cm}Ft%M)?RFm$7z'id4T( tW" 5QAy!8}54qfq: [䊌Fu4FȜ2JU"L6ZaXl(؛\jcfl͇Sam+<%XBTݒbtCjxH)ZT& UcRp8(fkrp% Iz $UP)tNdRN C|p[.1gL/%2>QaH*p2iԭIkzĹ&Cvt[<'Ak$7n Cl" (QJ'C2WEv$ đ/v΄y1a5%k4)?1gA,ɦK*FVdyֆ9%"r"º=wؘ6TPá0ic J$P%Td )\ x0Mmf,ZDJ&HM#R,1H Eؓr ؜ 6R*!3W!zpjpVh#A,(%Ly'4\PgK9֗2*пb9qMW"h$pYf UVM3"0NDjLaj/;^$ֆI #df|iyd׊ea2]K AXZd]HЍlІ! [r(DtUo1Ɣ0pۮx,w rTy@7Ja%%P<2D & kKl$t0̂57 QR !vIQݚrH_Js(JL.x&sBl*9D&OBO!3v6Ж-4!"6@5{TM%tHkC"0F~58}3[ P5`YMF2`BA*eiI >Ú7AFMiP! \920vs"V7,',D. V&) MXfB)ib>0ؔ\ῄǾ0ĊUjJI%^SRL.@ɎMgcjOu^E L\IEb&#,K%JFK! &!xiN t jO@SyoSm&:ޞ=D4idW2[ HDJ GIء*`iCq H4d- l NX=!}h43LiTPj# VV E+ C*^B+dAx 6C-Teꅗ*d5Q4H Q 3M ztA膪[H}"V!F*hAA iCXlY.#Н WTP) QH@He @(c;D]$( ܰ.$@P΢ڡ)Fr%Ә:eFʃH(dĕ 8 T*EE՘ӻz#< x 8`%,T sw 4+,M!Ȑj4 YfA*=1v(s,3JݘedMf̴!?AzPQᐴK ;A"&wΆ[DqN3T*P5,`TdE; )岙d/;YN"@;nŀRh["h#\2˕Q`HR!FnqU7)pJY<⊨B&h.50_Rhd+1n L'B̋J%z5L.LԺ 2 h%( _08,V5!Clj2^`t$U 'j 9\!Jͦ%v vEQWd/G7 47a7jDJ#%Pu$Lx(k7r) "p*OMC SbwƪuPhRiuQapWvKPQE\ʜbBMDsJ.ɍAY<%Q1J[Ztd[ȬnF̄Iq'.r,VꍡȂBF!2M3mGRy 4AԘTI‰>JBږ'*:)SPj#GbY->"qqAfGs 4Huk7U~܎GZ*d |RH] PVF&7<6"3HpuvCxB*iMw!`R[%0?CA)$9!O3[Q6[m$PuoCN2V n NbI:TƁ%\$|iqKKFbmA0.5#@nU 4AFZS#n efc1 B5ZHf뉕s*eL8'Ix' dI%dIk2Zyu9' Dn(I LpT !9y\!"䣤_ؐ=g#2OrgTRM^Uf2J'gmZN2$!ylipS\VD,=n-6[$MDV$Ԫ'ܔXhBQdUB"RQ10l\rL‘ZʩWǃ~b(f耹lbQ䭮T,W!Y i%rf3zF8N6e,1u6PpW = áHQ] -RaeJН=$4ĕ| fgoaqəxU&Pd PFbNc KO>D YKsoRRe]hlR-zĵQ.UDHTK]E&,|Iq6^bb]E蝊dvUL T:&L/`]SD::BܦNn"vi:|({cBMˢ3"`dTDf-k6GI[)UF̉FB^IЄ--@~n# w lMZwԒ3h=Szo?zF˨445ETMs|(F5ã%CDXa@*;Cq:tOb?ie6ob9;!}a Ij$ ذIYbnc!BV>B{ SDHvmpkT6ʰ̬U_h#U8,%jg`!ýrtI;Tnc:kHe?(@&.jEkTrM2 5F7Bm]I!ٖ&\T̠a̡jM!ȈvhmP҈@*b&XRC0pzhS3҄"F2XVRCb}FH2j?#_xs?A:1QFxQ<" Iza;+P`e$xjV1B ]H\K)\ب׭Q{ҥxiTTVB,c<3dg3dgqk|rg2!\eǾ?!v3FHWcWX+ a\vb`+20bM. j^^f<;^2b`B|AWfB̋ gaSo <,<ϼ<<<<<<<<<<<<<<`B<<Ͼe^}ꌰ(`( 0<<,m~,,<<< 2 0,0 p<<<<<<<<=OSa<EBMA<<<<</S5_  Ž <<<<<<<<<<<;?卐wkfǬl D] `L@;w,Icux"IS>$ NpsOh5-~-Xw 2 lP"pto"qO~GV3P쏂  lrFaఀ:#]<ƫ␇@jUDZ993^R%b >;ylu<"5H.5t(!2sobNmdSRDBshܱx`&a+FLQ2.ÞD ,cp>v`AM|zc׮8 ssi~!k]$;j.{.k!D!6NN#Q!1a AP0@`q?FH#$d2FH#$d2FH#$d2FH#$d2FH#$d2FH#$d2FH#$d2FH#$d2FH"JbЛM !&{w7|~_^/Q闇t'ğ,!1AQaq 0@`Pp?KiwǐIo+z? 1}_7)ϗϗϖϗϗϒϗϗϗϗϗϗϗϗϗϗϖϖϗϒϗϖϖϗϖϓϗϗϗϗϗϗϒϗϗϗϗϗϗϗϓϗϗϓϗϗϓϓϓϗϗϓϗϗϗϗϗϓϓϒϗϗϓϗϗϗϓϓϖϗϓϗϗϗϗϖϗϗϓϗϗϗϗϓϗϖϖϓϗϖϗϓϗϗϖϗϗϗϗϗϗϗϒϓϗϒϗϗϗϗϗϗϓϖϗϗϗϗϖϗϖϓϗϗϓϗϗϗϗϗϗϗϓϗϗ떗P-Ч740bbلQY=)ju+yP) }SRF+|h|kf+:QP+y%4~!~5CE? .pw1DO{tP`\E2B*.fG/s@l^Wf6g$)Ŷ9x͟E>IAAw\,ZtTPt(4SĬ2l^PaŢOŭ j&L9k-+b%F eWs=킔&#݊%,sryEQ^.$9=\6I cK==GL!nV{Yf!aF,WK~R^O_4ޙ׬ǐx! eFJ>#k -c,ӤCU(;u|Oy8{/ĆP]>{bB(WGa pɨ]if@Ef.3`bg9spEew)6xDEO Qՠ9旮2Y0ז`{en,0͘@deq Rk3Ӧ !]_ȋE9'ū 1F`Dhrno d3A+ 6'"l\(W2\*qRV/KGXYiW0=LO1SDΎ%g EKp3Vl0s*FNFY+2SK(y@e\r1+.Q )AРo!yk^ugcXuīSvkҿo&: \yOVK788gj/#+= 8ɬd(I*]PO8+ZIXPe**,=$,8tUy透S @7qAbu,uYa%AB t'YôPUSa ٗʀokf?3]z"˃EPD ֏l^ئ٪0cfNi> qoQ (<>[+ċ[<D˥S,JпyA#Ppe#B4C L d9bDO+mduy(KVnW]ea W.1W ik,Suʕm0c 3 ~gt&g\-y6OES`(/c% 5c[,xen^^QZ.]%~pv-V<w~p%A@ZiUcnj^ H8׀f]BMEǔ8 l.vPauL,V@2FGW ]P5odVd$"驞7|5TSiU˿YT/F,}1 StR{Dե *bW<@FXGYoy|e}hjDtqoU 2Oqu9l&Ab) 3Kwfr(j?|}3Q7E "{TNmGψzÜc((@l< 4[`3!Zo⢝áGAX󜂵| /T`څ^G`(@,z0q*ĶaPav0*~q,"FKAtiQL_`bF>J:5Os]jx~pfqP@ Q*l5|8:$C(2ʉ:HAYWlo*mĪZbu}ye+ "8TJqVRV޻Ks⭘h%XEi~U =8*DY4 z :p2͋w=*,RI} z/ZXK!تľe\XWO9@K+_aY\r0k2jPe{-\aKbk5,Ǽ= Mt{ *72΂dCAx(]eR_%g_dROdON7XUiuCh "Ă2^nvG3_RwЫ@F_w/_K,U++j֥ikvosB7 x Eyʁ, -9VbN75b_i@7sACzKU'EKEn㶕2 NWpu x1^=&d[^Ȕ׿%/$6?w|B% !XRmm\dEQQ!vT356*˃CFzqPYYʏb1Y|`.;%p8+zB}cmP? [TvoHf,[ZlsY xI~V-ޮ2DB!r-y1 -8oY\`ŐVl#!5-Au6ѳ*BW^f Lh:(9LX%e5>Cml+% 垂i6/`IȖTU 26@'Շ1ԱZΠ]NP;A#ΌYbTtŽ bA ^`&>xDhb{wÎ~x Q^KTV P!n ;%Ix'!.R++V沺U_{בl04؊X]'2 Iv~} jz'EI].ƇT=+l!^%/4"XӘz,I^PA`J21eJfk!e˵}6k SU̡4`JK父8Ήqf.ϟh޻Tŀ9^ʿWW# 8ItO&1dx /]ȏ%-dFre| .B(?dZ43/LPl(V]HoRhn ]EM1U2p)h c԰%3 kt`0 ͭ\1Uv/Q#h}DV4E-;Hs[,:@? Zs]4ɃUij|IzGA̭ZV {}߼) DF<{  KF .-GH(s Sļ)Y%99qr68i*;_Jxcتewel ܵ[Ԃƚ1;Z:E?95YT0ylחٮ_X UڻTGs>p;/H}Cnezu;mDWĈ-341wZ`7^mK.F,qx$c5}Kq3f|Upg ֡"h,BRpTmUC*ah MMџ`]TlȌ?F.?3dV64_0<ڈz x󖳏WX(t%l[ 1,,tWU K0Mx&sևT8;CdW! \O~ȏHT P kɵdHȠ-tzyr@;$0YaunjB j 1ǜ.HQ%m~~EAfD.{Ui 4,_}2϶b"6o])p)]Z!Vĵ~L #+" ;-BDsU8!EKaۿ(<Өl#YML`v4v ,vJaޓ` F]I¼x}= Q5l1+8(y#G S3 :? zBs5[L8>>S;WVj^%nךf2 Zh3W9U(6'y;qKp9Ю~T-nnL9XfpnP妹ehfR: SPmgLbgd Yg:wQYe͚"anN;x̀^%b%NuWTG] [dEyg`H(,Z(UjOW m)o'{İhgx# F*\Udžm۬:l_Xx@g;, DZ$ ?2l 7onݬ)<1]ev' hƎF۬N" H _.0e{e4Yo`4~:/"Xіxܼ{~2'}IwjQ2zn6-L9\&HYib̯.&Ì@- +Z 8,o `f£mIUS'\1^:ceW˘ddX( OE@W>6GW?V74)72prօ17S8N6JbF`$"&{X9Y'@˳^b2C]<(]%ȩTbgk4JD!>},<{G;CN&ӳ>w.]zLڶYaU9fإmMHo0h565 LVv􀯡}ll"Da5Unȗ@+eq\Fn ca{̛J+!`mbh28BݧT)T/WQ5ܮv7eC` :^;%W^U.-_j68W0uPanuFD1*,si]( xo=wI4bM>GVi):&AE?7#rA+w/%j)2 oT.`KXѥ0 #.֞n"g<0& Y` TވK]G6SGy]7X8U2dB 7l {)ut/A;XL  F؜9v+ |ffO:C5C;Cu0bIU7#B@azޑ߻4BpՓéP QG *r!I=D3eF:Q'/)JQZ%fcLPJ p_3ZN/c=jPOx Ucws2P@xS(Z>~z?1($׳"XG"%r/!` +c;0ۅz>K[]}2]ܽYoTq0kѸ(xo笨qhU9hTYTy>9OVZ9ʜKiD=&. 7}%RU`fZٵbq( 4u2Gb|"Qj6T'h5(_ |E|;?lOs2J2TZ cmz]!ݳ0| >q6w!Lw@Gawh/RO_ikBIl,ʚ1>m2WOL"*Lخt~ =a]aN>%:Fш[k~,@Nŏt STZa%8r2v %cנ/ rZ f5y@x _YC?od+?V ‡Əed>؅%;2bM~/[i{ ػC) C+!ͻr.JdiE ekˈ^M˲7q#2&evg5γQǬÖ=b᫥r!eQAr"y]J,O8,W9?j@g׌>e-8Wua_r>VE}IП.A{8j hhTڴ2 {%9~n$&W'P<)SBw~yo̢Sbj<<*ʋgIVab5\@㽑q1F,uQroՑ-]\M\ 6ۦqEyB$zyE lJrug>0' %aӻĩP_xY{oA"}1tdόs?űrs@%5`hq2X ;FEm>G&vfN-x ?]Oݫ' TZcrQlZ`[2r@/KxiA s@!ns$zw~;:۪Zq ۟]dy ǫAAPkd{_?`SXX;a YvL%4qEcOVniTNg"Mr݄8'̀-?q1U>P)"nn Z^7kj"Qb@+ JEK.w)]&i}T]Dj'-Tj:ǪQ2 Wh TLAqYPe嬧N kc,TgZưZ]g(&O'sQi\Vk9a]fu_񸻅z:kz˱mz"Ջ;~?(g24IJ*VVw4\ )F)҂CǔKlX :Tr/htS_x}G#Z4 #L򻑵ZS,+nZum|㥣J.P#X/x2{dd㼾V3 G%8q)v *ϲ91,x[飘#.pEt Ԥf"06,S7O,7 !@t_7 5F[,9_mW+.VRKf߷0vWweEԍ‰~Gn͕7N|?Ȱ bAžz̟bJnY>$ϋ8z=W!a&U[NPGYu'9%`AyX9˜|cؖK ؍!&a:-^e5Ts {y3wۯ (먅'=";[?Y/hrdM*5VjܰCǩwN!A_w״"t-1m@\SblAm˽t!g6g+J]k-\_a_7F@2yg@GSr=:p|ư@|̘2Z~l%W6xrvOA,xbyg/y׳1, b9!e~#g>?L)I j1pWf6*uMb-Xa=m+d Z8@o \ xMl\L,f,U`)E(ekY.Q Sl˸Ѐc-҂4 XK>~e -~Ȑ :0qv/R\R"jڪlXYN`Bx?R:p XVf@+uxcrv?./߳{Vתv-o >-;\IHfyy6Yf,3Kț!c7(eh%+9p@ޟiY )E?0=n--GX+ph h5~i|M,^V~8b8g=a[utt6rN!5v}e c5dK1Y? yF5%bM(k՝ ezpp ?qZ ּZ}&$=&v4OCus ,4 1(X<+ a qG8{ⲍ4;?hS[.ϒ}QI.r]뵟E[Y6hE_}"#2ZW/aZOl ZaWN|v3/Zk} 7{%f)XGb{t>+iz'aR$H;~xDFK8.}_{7R=b'Af`z= >:F_hװToyUkNMswN<kn`=ji!"<q?#OSTޟ;=Dɭ 0>ev; 4~_nAA$Hy*P (0-xt˻m!Ve{_'v3܇t6=Oco_z>a#ŇVV|M?Jʫ 䗹}<_#yk xN׈tc\*}l|A{5K[/'Dģ\GmZh'VP݇KO}?ERBO}?E RB}?O}.ϱ?O}?\B}?O}- , }?OY H[`3}?O誰";/tҐr|ɠ6w5 ? c> c> c> {: yRy iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiihAI?O?'?S'?I?S~?Ii ;t vkxO{O{O{O{O{O{O{J|||||#|#Y> !(>l#g?IOi^'?=?I._S)O?^>(O O?GO~_?O~3c'==?IW?I O~O{O{O~_GG}/ht?gfgf>Ipg''='==============|xk }=====Jҟ(xO{L<'========= `M Z4;h^{1]Fb>̾G/GHP '$?O_)9f1ӎbFyŖ=#}`Yw)$Y>3eS*k*$ N>"WL>Ymfg_%M*`LeyAWuh.bغ"/0U53V'>Sqq .) wqLzF56ʼnw (Qx\|)c|S0ujs`VFSa2M:Ĩ:MBfҰB^\δU{Oj4uB, -lCqaUfy(fAsL1;\cF8`x;>r̟9H1Q/rpWS.y8*}qP&+UԮJ0ʝo'JKAz;qh03*]RfXG.a\t*-IKh3=ul62rGc=aNqN3k&QyḆظu>}&cy1a;N~7} u<>|Sȏ㌄K%δyǒ2=yJ/1dzounj\;#nn9cq:Z6̪cG?P/7󌣤|q.MTnf홚#8n]8O / ׮PtgN3*$.7b x]-Y/8zEՃ=FZϋMvLnU;f=9s4:B5XSq?2JŬKxs58X 8G@YSs3+V:˳Sd%c!Gdayfv-=J{2G7T$k5eKl3:bw&HW4M{jU]/ ZԾ&ۈ(x5Z-rˢ,W2ͽX`%J1b/NU-]q˗,.91*ݙby%%:J?3J8i/AoE(T"qc(]XBʉvSp#vcHo(X}"WCr^%5Aަ~STf6űMO9@E|>ex) _ @pa3aeadIKձVfA[\MNMỵH7Sl?sGz.qy(C]aw,Nl]l_u;٫xG>^zF ǜj]cs=>O:\Oqs60 E5IᙼG\D58zϏYrܷ%9T㎓fiuiwTOD }(f&ҰcR97XNnV7 AS3+S<%/A_~#[Ctz?f;vD=sRh>aM;+k#t35Cc WI)<_ X֪Vs~;bR7_Yx]Gx5|MN^K,әyV_lE;JW]!uKűqPKB+(n8/U %wKBO:-_SQsYevWIx.Л #"ڠv-gsRlZoUpֽVjbZ s.k5\8u6τ .TB`0n*5/.Idrܹr˯˗LzJbOYU+0+2D>jG| MZўAxp)3i1SkYt8T՜x7+5Ỉp}`ffs jLH} LgW9bfbq}V.^9eeI Mq%I0n}ܫysZ0-&J7Jdr)@;/b5.^ڶ4 p s /bi{Ŀ3b95;8}Ac\u+9(gOO9j'${NzOU:<'үl_1j,38_JgozYOY_Yzz¤]UYG`ʽڕ>3CNK'g_ԝqjG$׮[a$?33;f%'Ses4^cd10+O<埣of~KqgܹY9.帎|>\uf:/~-=xweqp2T%* 6bf[13\6_)VŸ}s,X<ajnږQ-K|c8 RΗ ٩Ԟ3ɟ8 K]j3W.V:^c߄U}/w w^ 5ա(_&%\}+ОDg5,sT;}.x5<}1u 9!VeA?U_$vAv^g}Yws1LCIy|ܾ%c;s.÷y[,s9y GLo-0su,z79g6E))1=Գk& ZUp7} c5<-dܢCfgI=R/gIh\˸;'dC2q97J)wG+6tMM9%/x}-/ɶpt`}&>ss>&;7%9+xܠcg12Nr&3Ck.Ww姅8nAw3sQcTZͰv731f%1ޡ׬5\28u+sgr$B-jb}NjKfo*_}+:%\Q[#9TV}]˯yߙ%P5Pk59^<~ MV/BN wC\C*5s\b-+0=%VXy=SW/=c17MTupoXvaJ;Gg1;MF ԰{7.Q眩YE:w_iξwq9[kA9Uqʔsw,s.uA0w^'Zv/0U^àeeŗ/,ޥfo?KC`uF,yϗ2dܫ֧ega ıMJw1wS>fxnkyej[Kq-^ a\__aYE1i^$\x ys<*i䏌jpms82Cnb7YI,}GxnXUL 0E78u^2թYejUW fq.^:K)߄SE 컞 CqS BW_cZ*[v=u>|Y,+'Eǚ~? QbygRq)+PMyU?xکԸޟ35WǙ$8>?D;f&StQ/i9+9ypE}'/P Ug隈 u995o()@mYMhJͲE95/7wgʥ˶y}|%beë;d:pQ39<1%:>3.jqEK~sz9M\N\JX5 .xvebK"BGVߣ؝1cSJhAbιr_GwYSr4t&/Q^!-3Ƽ㸭qeFxX?xcST58*LIs'~EM{|}mhL)*N0^=krezhϑhY}g_O17wNsU<&lBynyg\˲G9T(YEŨ} &S"es/yCefWiD;@>13yYSy8`2gQU~Gfx=/'pPMjP*idX&2I5!%VɡMSf'ne%qS<1}zMLBS:T!^S#9]K NOL߳a2MKׄd[Rv-#rs5 \UGNJLʎQ8lEavdԻqbkzE\FX/$^s/9fZj䇇|ekʙ\鏡N(mRp8Vg?-\ͿMWw;˸OH$m(ulh0:J:J))(q(4ȗYQz/v}8g韥fOYL-`7.psn.|efw3=K8^;I,[S/kՔn=%  Yo ̾XԴrj4LAfW85P%NfN*sjh+ lQoh>_Mb5,?2B/sY9][zۈ)|GFv$yYEt4e*.˔G}#ImSxldt8L= "]<LUr^lNqbCraK/r?ZW,. IJ|Tޱn5O{9 MJ%Gy˗.\yn^{ŭ`xV)VP-Xͻ<^ ^VڳYr1ز;n:%㼸 Ks`\/ߜ m/q;@ ie25w+)@o2qXV}%K\ zï3ߟU/F':9fEŌ,zJZRq7eM<8 "?/E)@Ck[.[-/kRܧ,}1+*)Z@tz_O;GSW1k-35f=xNSPy(˟m5k*mZ dv}58B3y}Ȱ3waümM9_NGKnue߲v_@Z>2q8@0Ҕ _88 j!K,*O"R%^U=(uzkAQXZ\;sf&YZj^7r1C`gU誣x7̷U4D=%fnd񄢡:A@NgwD3|N&Ԭ/m1Bf'1Qq )&a) =TLHJ54xk7q2= hDu~oH/W 'DxΒ8GqI,EC7L(/yFbe=h uA]ݯ~T2SOLsGzI˨fi1Qݮbg͌ܲ9,xҵA5w Y˼^YfC״jJJ~_h tP>fl?G Ak5&Gـw5/zDTae⸗Z[g˖,*叴rsw3215~GKu?.%z".BC%v]jP d6`/53Sz|㩭G ]E}_u5H[=4Y@Րnju>5/)xe WH2*+颒8'in_.xbrTn ~1/Fey 97+2j5XUC8R4ƽ1 b8}_5'3c5KC/ZN2q^:5O1] 6aNVl ,A2^#Nv+NP2 }+2uvd\<كyB`IH(,O`>wb:/xg Rs\^xz'I8xbcFCPb}L 1Qb"USs/ie Z;W]SSs8߄as\-ix!؋q%1:K AM1*R;홴6Uw%ɎĬwҳrUn;לZ/ֿ3d5Lw3mZ^fbQ/gs!X5\nS?@sHD̈́ļ̈́s/3-af7srZkxԾi9RJ㉋.i|T1{ 5xscfۼ^1XCycIl/NxܹeR**/pf%}T"fԏ5/ZLl}ˇg=`t8:B *s;T\stYYLj_i]aQlB]fYb3:累y]7*oG " es;CVxEIi8,fތLL7!7seep:f-NJιUUzia5Boa8%56|b_I'lBy237S/߉KgM='᚛9'e<>1Ќ }Xa35.7PY %^y1q .؊wP kǑ0G|zMFKZ!|918ƑexCPeB]3cnk=#Y=Mʮ=c.>Mx'>OΓ])r3E<~ӎ'n09@1k` Tp8j7sJWplA`5ؙ/IǥV4S>*ߞ ux0T%\nZ9D/YIdVfl2OH4cNaoqpJPX1vUo\V&w/DŽg,P&F,.e2C+k$xao$nl&Yy\ }'xK\xNE"Bj!-$ pWoVzȕs(2(M͕י':7p:/H# q sZ󿡽MY|xk3P.soBNMZQKFn&WodvcΒF<< fx^v3L <JN%aW=a9koL<&WӟY3Ŕq>R\#Wҡ :M:vZrk,<(zغf~"3g&}ͷ)K1k$\Y--{tdw`)iEI }!j}2O2Az;&t/UMjkp>Yu7drӭީQLs#*ı;gU/8!-#1:8J%|Gʇ9.P^Q-g-,2%vQ(6G- ?yJtyҨN\Lc[rDs\FuU}ֿ#d|%D[Eaz `nC]сtfs3v(HlØW 7"W+5iF89N g^79`S;2x ⵶k\%Q35oG779x}dJ+wyB YtDŽ]_(OH-}T}b u%~Z 0yWl^jv>j'r~0}*2_kp-Իu Ӝa3 hy|>9s qq)µ5]gљjlpv]prZ q6bX8k[\O0)"0/okIsfyVwN;\ NFssWyFg= TV(\RәYA*gr̞0P t]KXOs0)yXU/?]#̜_1#ugrkr\c-bzu 1oIfH1=Ě i|}xa TTَ.9XNN{}ifsՒ*s1ߧӼ fXo}368vs |> 1W=*8%\E~gHoS{14Jc3˦,'#LǤg1P>/REFw73+ YgSWsh\ޓ鎳n-K5̥ ?p'mcbwS8:y=fjDε3_kf'}RDU5S *&ubbV*pUc1]+pKzJ\y4s&}R g׍~2<f<.l:#gi~;WS7HzS>SyO:nqq3ҡ59d#t%*wr[XWzcCxr>ݡIJ Ea@'hfj:q3zKz[Nxs+O?9G 2x5sF|%s$I9t1#6A@) ;;@N߱k#к,sy@p4Yz1gx)w'/@Vey^/Yf0k;mݘ,Nz 2Ygznzުv5'k8ˆ7.n= Z~eef",/~SVoyj&nm!w_ipuL `x@ECJoiL A%Q0@sΥ\ -B&g;c3㙩QCS)-x{l!Q#u2mq4lŸלH2eϜc=~DC$4/(Մ툾*-o(yM Xe-"<77 +/aE`&Q=ƛWe԰FvkM wsT_|sC.K85S33>8+iyQ7  (m*U Ze )| :aD>1T3=ru;ˢ;1N'IT0MgRq nbě qNu8rکxr)iJdL %[äl,IWze\_FR4 EssK3>("_ә"U a-cg;()e<q )0ŒR8 38ԼܼT5.ׄoåjY/ :P8ԩWQ77{G^ѻPAJu!fw beT8&bWX qV&j`6VnSfvjU;xM|/\MB!w7A:^1OIK7CLPgM&JԨJ ޡ]&FPSx1A>-s,Qf0vsH==#6*HPE2al9K*e9m'yR.ssmKlE33lyJf:&(=+^q:4M3 gZͼ F"mx1]eyAb|f ]%s?BCV) b& ^_$E2n5ulczAkNܷ}aSi̷ueu]@er1u+`T.7Sgx-ﹲhwyMniq\ꍼcwR[ f}>>>Ah#SPsqτzGw^1|bcu*f{K'oPpԻyᗚ)gٚƣMY,ܵs\"n%5:r.50:+BY,rO> 78q1̾I5SDdxLI#b^nWAFN]= bˣC7xMҌKN񰠜%`Ye0'eM-.@6Ǭr$t!BDK+4 rf%xPOK:'ÊRpJtWbY+&9 h$: |yV"UX YFDjnhhlABQk8lSq*^j9PDndɫc+3 _]Į0*>r9"_BЪm%8TLQ_("*8(L{&L Y~^Oǿy_~Կ/XHgPjZ/^-!\3J LSO:.|k@Ɨ#8(wLkܨ.pDr2.x;zLXNewJ/=1<#1p:ְ1$RQI%­6njm^a1ZYeD֥xtA[aטE0 ]K ŅW⏛KІrZ_%C~35%"W֭cZqߤ:8̼ӊ̙z=᩺{7*є&5p:i,R kMngisvگUWD1y`Sƅ3U;NF@b18s/n2ez!-69s>=sxoV;7 ~ǼJ#B"Ux+)mGEb E#D0B:oSS+c%N'1E2YbYq(x٭pfک[WqbM,䵜G K{J.-~!=RSEIiLe^Wұi9(q+9R+~_G[4~ԭʼ>u8TK%}wByJĬUJwW1MCL$  em@s*ѣĐ1%gR$LBR4g1|X0 '*}zY6k3:Th3TN|k̝ x \j&0TGf1febP'{α.FKWf_<Гm]b>zū|bͿ>&o)|gF5 \s埦+rПN*N&笪f_@7+I9h9&HΧM[6N䛲cttԳK' JI:X9_A i-%s'hW33Y{V"6?_] 5RqrK㘝nls$SǼ N7ؖb]kU}Ԧ9DX# X\90)c-X;?['ɽɽɽɽɽɽɽɽ=ɽɽ===_>i>9>)>)>9>9>)>i28((<<8(,((((((((( ({iN(iHio?maiw,DᤚS>:IEQq>>q>|||#||||`>Q>!>1>!>1>Q>)>!>i>ihOgL6r}1 @WW״״Sk|:O{@;J;O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{O{L᫠{E$bFPzO{O{O{O{O{O{O{O{O{O{O{O{O{O{L'Ƚ½ȽȽȽȽȽȽȽȽ_ ._iWO{O{O{O{O{O{Kݠݠ=GQ~_y~?O?SO?Je}D`/^3>A?O?S?D7S/?O?SK~?O{O?S/ԻS?O?S5}Q~_Q~oq~?O{Lh|Y_Q~GQ~_Ge~_iQ~ac~N`f"3-fzK/'@1eR $ˊrWSC% Z"gˉ/i/hWi/hiAx\JW|||k|g>5>5>5>u-_inWiiyO{O{KO{F_PˉiigO{O{L<&z{#O( -?Yk/BN¶ZxͤoA³0(]8?]s6z6Prb=g"_LuoRo?7~1^o*G)lEWq8ϖMH yg?pd%]~g xXBaYdLxOjh窧%,@3r J3>ǿlBۨyqP^]N5 FLYTӗF ]ƃBrUg8%jnXʘ0gH 5.5"s$y2~rQO,20g9Jorqs 3 p7? ggygq%qQ7/1Gcx-L95PԧV<'R]/&%R/.A4"iQnc3,=V@d}b8aU*BJNҒsRպ[4+%I\@)W:Jy j&Ln4 \ mn]zEPxs ۋZ̢!fXVAn+}[ rsi{*[bũ( :2|?U箪Eaza#8<+q(?K\.]}{TW>|~,ζUj6iyGƦ 2N&ߖOp3GkkQy%j}E(YYIP pʇ@1ϤVq1w6oP ̦%ՙI*s5+83ԬmkIXmL:2Xa4:J,r><#,U3`"60 Ut'>BaơvsQշ29m" {KXϾ^?gr Qݘ&-7Sj11rd*]]t&2UDM8%QEdrP̴N{G9̫ :.M]bٺ#X/Ls 7N q %JGsC(G9u7 `j6Mj_<I"]OUVTZ XɽȭX,R |`ѳ|_S.y}9?Z}x桿˗,y}w9\GiMüǑ># kEϊ*R F7K@ъVdUUW9QFZn:䪛fj+BDG)[^1O*-n'jp3N#/K)q(ssqq,ZI>ÿyV^,Yw;<&0Vƚ<${S`qrpXjɐoA36 * 9K Vf">1Wв'Rs[&v9:ƣAF;@][ު,fy~g%8UY@ w1 2QwVꉁZIH*cy1uQsJcc/ތUY icŜ8Sxn6~?sH4f+/npgL2mr][a. *aJkƬ^b/n\\˗.2˗._⾿Lg_9ue܇L>}fsύroı? F(114\ƠFuHJ+^x[[!u7ijY^3u^gʗYdoQv'7_}.};^s?xc̆mb_>ҠxM5ިޣYko/R7}j|wC$ 1TM~?y`L._焼KrLk_K\gr?K%/s0i?KrF~XXe;N>z,fyptyG 7.DA-& * cbsʕT((9ܮn9]c{@Bw{ʮU/n%x eYux~ffzv~p@߸ [6Mx+WE8K*^Pw0z%Z U402Ͷw.L4wցMu)o,Դq9隅,1p #s(>ҖXxVo˫̷\$U)[{5 kFW  QқYh4k[Pxh+ e^@{F?P\u(YgB3]f*uq{;~B `(k%;G,ko5AB#cgrn>`4MH)ұ:֥&;/3+vl)\c3tD*wUL]oxĎ*ĿcyŵRx+qL 0K]59 Jqϗ&>H|Ñd.*r v@ϿJfe0&*'U+2@%.Y.\39w&>J11sc2̯ SrCfœa=HbM,Z734Awg,h7gHߘ/2w]aW6vQ)/2 ܲ]29\cRJFx73\9Y[7<\2X{NK% l({,"g1YYzt@ۅDŽYr2)ΟXN\\tgq} "mPyP,P#X1b* yqAŶw*e_$C8QpTX]80YpbWPe(Rmv5>?m/iu^u*'SSRUKԻ=¥UxP(Qڳ瘎g4E@R8S5ḷ>eq-cDsp+ӗnis8o2[t'1"-;;+,OzYqCl14f̳ @!1@g^/ϬAmrˍWYih[0oXaX~V cԵpŲ1qbY]Σ[*szFRhk[uN\X̭W4(W TaS3̥'WyX+̸ˋw\˗.\r.\˗Q$@yƣ)!蜳͊, )$ysIЊ͖]ݽe-:jmfu9Kjˏt-{Nu 5^w _Xa䫾]BueCb P̪ jW@g` oeLqYف3, a v։wu.ݸ(؈&cq%pe[s+P ƢI67Ѓ7|wC]Q!0S/F:Ѩ(hLxTƑ/Q/dV f&bK&`u[k<@ͫDZwiUL*؅*9zh^"X#-qS.0J±`]RnQ8RUՁ&x9*~5טCcҘ-ٸJkt8̹6wL=(; TK\^x puhEB^g_vrvU;@tCF2Eɜ'yyG蝨'LoD>D=I۴쩏qb }K }X9]o;,+-NZ2]g-lX0>~=a9&PKeԿV=5(e&p_SS8*bZ,Cao3R胜x!6{L>~_|5 7DžP-JqW.ʨbUE.,9ftsIWtū<:G\Kb0ݔG|OuMD,)HV,]kL#b͖"j˶JKN^.eIvlzEӴd8)J;eӦkQ*pU%ۂ[T !3ΥWC s~q41>PS/sT(*Mc1`Q=kP (`<˧aN`LU@R1d 3-Xx7r+r[8dTvb>{ff[9ea^ъ˸75/͗nc-R=P3y[&gQ3 ] 8q..h:I0"*^k,tXL]]ˣ+%*+KġOQyJHemrN>:;3v޲'y?L:MXSP5+9<[.mCpW-i3ydTN8L_a,s0GT1 x`'qO[,ihonV^AX[)D$geQŲ_^F{!nr|&eU(όEC2j;G3gPRũ}JO,XiozLQC5rɫg@s>3G3 p-}T;+p~a)&/XMsbq)ދX&3=졳o* KC/vT-.ziBWX] =cyAWU * nx ]sq7TNJZ uICϬ  ]XV*`zOd2GYgܽ\˼g]{Ix2˗rckN~1bk;] 2K :״F(=RD4 ؅9^ hK9Ip]-KbY."|cZZ "tlWP7 P>CXm,1Kw,"'|N7GJBqOyw-^_CQC(n)#v̠Ehyym u0)evu b=f1,RfOopk$`p 5pxl8"^r-u{Y FeUBP@87aTG,i O4BHܬpYX 1JUSVQ2) t6 c pw *QTO-5b7牁T',)j\-5ҔYzM Mig8"#| HXP.XPz(H\5u?1@ а񎒕ݻ['e`my~eCg&\EvӑLZZ*!?_o:{4jzAڽj F:-_rPZPtxL:KP\:.; Cw$3O)6x%#0A?fU]vċh;9uFMNrVWF눘\eŒKI/)|f2pܬ4k=aA"C<Ex fTr.T.=]fwe%bPTPr=q )L9Y|f3lrR,&9,Tή9z#@x( \Īed<Ee30[5gZ{,:T~g(-C c:#aΑ{Z*:)V>њU;2>K|,jhEt@ &@0BNDa׼ ;_xc&PsY E[ry{jϱEp vT ͜KHˎFΖXZ^0;„Ő{nc eUHvNYR4Tao(q[{}oҐ m0ݩqW AjV *VlXxuLq,fC >ʸ:Lb< ;38 Je!|DJCo,劖D1ps`VP %̲ȃ0#_~E)ġsCձʔ lXF_z5ZT :,[<\Dik]c-v'q)T0]x ⅮGmc1s2qgPyEEb8hz̴A֦R[;V+̬k|~3Ca9{ )^ 0t@Q^3hpHUK#Trfd.򑳫1ٞ0qk!B.|9]n=ew]"sP%1)ũAtRJiGk$//ƼX\gXcE 1n/3of`6%CZQ0ׄLwPZk;%`⼼=ejRF@i Q7)AAU&U$ų"p&dB='uY~j9ޥ*s.KXU[psGX:żr;N[ŲibE$(A*>9uk :, CǮ,V=IS ITM b xȼv!TݶvS+YU'@fJ_oG2mpi\Dթx;t;#5Pn[|E# q,y'zda^ҝ^RDZ# WEu}JoSsiiGgwJAK>€KEuox;a[RڽV-# x̔x}7ax%졠Wd)tyAuf@QW}㙀]3HP^XU ("e)Zœ`H}U9RƠӄ;TZ1^'3#[n6X.YugBAؘ3kxWX-1UhVnN:G(&smCLiHa*a@G3SʑSy Y12t/-Ae-g9 L]b D&qS[<{Nw)Rh4֮^*≱m] 0Szޱ&Y_O|[فXW!sPF ʷ%@4YӬh!e4Rxu {Kk3Pux! ^KV'e?ўsi)tv!rg;߬p[7z Kokog_`,xfW@+ ъ+6о8xTx>Xвs+-Vbx2PZuUXW{" Y Wn8M P}&P AV<̤)'\RH;aVpa$c_:04->6/]) Jz>?ܳ~O}o, .%WI za]s{iWJP'X3Q ?Un!x6}gXPSɹy) \8]û4mp5pjP$EUiJLK3Dr8S.̜ K~R]= aDcK<ٙ0&WYXxLXx88wh42 튷ˬN%_u§qh.PX]=%B*CqT/1+í>32GW~eVu>;_ @ì #\L8fےSJPX#1iq} ,(wm@oߤ[ kma 0̸U9 6Ga-[-Yb;J8fUptD'4 *1o,{˶ H%כ`)$Ak0bό,%/xopg!x(9+ EFɘTXESZ5 uz'SJS V6 j"mh:efYj,ɹ+[se0MeC9ÀZ۝ƅTe1j(6; 4(j!:HƗqL/qm{,/X,dh0 VT^U8P\X=VZ2O3״(pt;R, >޳1i6;`ۭ@wCF9<&RG|T$!vbg _bs+j''S(Z8aKU`s WTDrrUSDb6WO6C:nDžAwǖw Cʧyko:# !1xoux'e1xËoŞ&mP Sr>^(3s Gx:TuܵN`o_fk5ɕĠhg eLrʾfQ]`cψ5x ԺZ't|T;4Q=s؎ht j$C*Hk5%!Z pq6 ~b.^m@QeM+LLS˦(V:̀!b"=*n``fAps6DBK_-]J]ef9:Gj6Hkc[W2 %^NHüܵaa,Y-@ ^ms.UM5(f+uY3⛃jPkIC*~C+8?x2{,Z|BWVfmT._xT@ ؀MolZae9qڴ`h1]y Y^' Y-Βc'RHVz."fc5,0ۖO 9X%i!b#6ۥ2/C~l ZǷ2B`i:ʜP,פHS]Jɹ9h^%|^ZY@ۂ-R]@!E(nJ Fp1Mso.⫪m[A틬KlLY):j`Slxkmz3*[=%VU02Q+#jhUy# *O"e$G[01x@~;U [ bZ!E-fF,.6po\"7Clb'34" }쎲\%iD:Crxcm.WhP7#g@:=(Fn#u-s֢ 6nj%ʱ Q)rƳJH)?$ڷ@XLB QT0U]>0imX4>V5g+:"5.w1^F9P\U\68Q :jixv1*4]oH VߴvKn6ꞟ.Qo .\yJ\չFԣ4pp@TMh 9~ "G*!2,3q Í7-'NLT+l:e`H[v`cFB*G u=S,oR̢F1E}A"097T*R0xuCMɟhPH( OZ"㚙z=MQ-mwS5YmKa a9jo< M=Q{ArÞ3Pw{/Inn![ak[gmw:ncfJ bkY8ݦa)a#O) ԈDp$m0c (kٛ166e9@ 4į,%Ti+P^FnKѩe⽢dX0P0|J[WDMxB[o]!>`Wkjե\cІ?au j Ֆ# ׼lȠ<W3cx W1j 8h1MP1VJQ d0TD_W#c78&}Y+ߌzfxwb15k`;g]hhP+@n]( SXfFuOԶisenBsPRW L LS2 )|3Q]YhR/ 98*@N;`ƛ_JLyNZk\718MALAMtts666|>@*[(CeCF觙ns`S`aN՚ SYo;7-  q/;GEve 'iAXE wb`4\Ky.R7C Ts2cs?/FQ/fYJaQriHwjecZ3YT1h8Bcv33hTO]gگD59<#'ha%@lXAM]bHo9"騩"ӈHF5ȤK8.Lj^z K]#|HpqGDJOwU\Y*3œm} ;r9{5 /yXu6&ߘKZ!I@I{-!F*ys .1u3L4&6|Fz:phq[YTG0B;]4lFjW*+ W& ,NV>(}u\xb.׹0VW:*ee 1v'Tݞ7R XO:^' tO~ @%aI눴&Br _ j[v@s;I* bk9_]?'M ;~fdKiW!A8Z}n;>%C礼,WNPRVr׋ٖ*ǜ͵y3ZduyX> <`sjJTk~.Z,%qtV?;Yk&|z +Jxwrܕq̳/eTeiyÉy(bdRaa@\=eȧHdqL:]T=FzBaE01,N@ʱљ2ԡhA gqA]aEy4\=Γt6so.bhV޺}ZZA4bX-wdc9++[^qje9zoз0!KTi^_(j~NX-],dRޡ{f+Pf4\sdT(oq򘫕үޮ"yƵ.ޠmxKTtmxݯ]Cvfn8t/̋&/+τ.')YZ0nQ@I{8i90lBbixBvX܃֧'}ĭL zOPS.:GaX¬mJc͕%ڝnrˮ6p^zC pfZL 샆y9jZ يή+4oWҰ_nږQw;r8ծp?G0NCSw Xyp"VʀY;7rԮ!sfy ;k+(etGYT17>#7d0CQ(ڪPrZ\cwO}@(#D6b `Kr`G3c;MʢZ[vRpq:uAX;XZH=GDcRS JIrҏjWk!dkFx%x*砕)LuX PֹL耮>jD]ncD2.-s0Em"(%*񽣐 n1]# QYZy1.HHQwJ2p&"ܱn۴q59Fqg~cR;<=nA{0Y"A3MDŽnM~pLs(w.|a& )jG+bXUw̳_;W^1U);wU2SRFպSUЛ_rE`-9J6Ha1\Aghi {`S rL~/cy|ob1\Ator^B8@j"Ìsb @"33[ Jh3y9Q4+Q/YkW]%Ĺ gU`dڨRڝXkN1QވԲF(cR%* "5_rZGwz(p3 .hAYyOv5DO2 K KC*Y&ox"p4p ש|wPc;nh{Eb q s70ԧU.<*;gE4£v5K0,0Ջh@d08w&eFJhhp^IY`1xۨlA`YꞲζ 9^rjhveeI@S%5/%Ch*e3D+sBP,޳3[Bج;\v&wf0iHdmSЩJzAxhC XXM+3:REmF0 Vt8b!@`9C3m4tDe@t8 pS5r NI.102N.6Pu" <'2.28F`NL9̤pj_÷X`Pdi@&8qM+J'aZ`0s**hBR8zīaV2-\_+ʇh}&8gA7\nDp(giV2yٕDaZ65 Q[ږqus1Uv68ǁ߼/b ' VA{V`MC-Aa#* :ND\A fPXy⸋p/^5\߄JWXxM"rF;N8xmN LxGrh#PK &XXLð' G.)V)r*2*iͭ8XR%&nuf3b͛Jq= b#>킆_+ jΫ0k"lKB/ϴUH >hwpb91 ~o4Rғ#(; Mhу tbME7ѬBR""mBU) @7c2*X]T boDq<7Scg5'zv"<_z#cU]>ſq G.efIWSKemi HXNN䈐![ sFw1E;qgkV:3A=EQlrPY=eGMsV—u3|TWvd˅u]D[_YhnTVn)$: -P9= H9Bmbr*/dY ךQU5rkZÞL%/w [3*/\w|w3;GU-~ sr95%3Lb[<1='g 3!Tm>3wa2 ʿIi>r9![#QM^'bD֠ag 57D\t!Y11q:lKu #57*ݻxUJ#؎,&`3O&-oV&8<f'MCgbnSw`k\D DXUTn \M i1)vJoѨ 5lu6iA qfe9jWIXܺ* IKj ί9'.dz>|- ,V.Pu 6< \-PsQ ؚ1WC8",) #ie&bfjKKH1QlJ` EbZj};MTĭ߱tMsXꜪ܅-R\]' iUȐ#Wx) 0E}`pDJ2boSnUdTPT*<=zBE&ED ZSqULo^0{ P^'b eu070UU.1RQ*\3A w0q]_x)7f ȶ[&U.5[}*ѷ=PnV1RRQu߬&<pRsy9XNwu8sy9 j=AO}5 8=hC)KsrjJxdgFzJ{Hjvĕ_ ZPR" ΰz"#(5[ K q; QZ6D9`0.!5DZ*m)`ԠG6# {UNgȹ* U:1`򃴨,+8];c[f[1*"U8Dl,X)a)BS1VFeye^y]\oIwbGYE+Ï.$bC(Trvg S(d.ofcFJ@%\PFCV#7yc,UQe, @8QHʗAתˢ^@;IKx :ߍ!@.DChI7Tʹ/Q:C40^j[[YfZ jKKZeٯO"eJ&5`nS0?NT[7 &uV ~p+CHl$qO 8ZřZlah2Yb f1xO^1w/u[_q5|O3G_&%BTԷD(aNz 70Xs KBÅZjFU @D, |E77-EyT 'Oܶsg9KMiBXF=%}ceֵ-x#qʊt@ɫ 'il FƆ kAFSc`25rd2 @E 7Sʖ1V1o(6|fHw%:+Oh]߄ '&i r|~o'\eo[T__c'Yv'Lg2^sf`q 31q0%5 bSA5Dta`N#[1r-gRV!*TzJe=͞Л hg|4K#*6pzIq][ca _iDUtd#_A6ZDnβ KS",!f&;zZvYDivQqj-`Wt5w `!j7qtԻI lĬq V)˺iWq\=T \U\K@p+ϔ8A-.\@V6 Գ%b ',,;$&nJ,pJ12rEGˀ,xK]_TiߌE 7 2D kÇP# )|px}M MO8ۛŜ4]\' ArLmuVR K'ɉ-C\o ob hzD );~=ծ߅fjgt>˯E˶ QtLs4Ja[N(\{r!سzmU3(x=0ЮXP @;UYPC nq.HCFmkY:8RjEBQ_H0t3ȮQ2ԡw{W1yNRo0Q.!iKu| B//8ڍ*˞X8EiCq79\X̲n^pK /Qyܗ-gh/Kyz-q/5cNa#ڼ]Ȣ~T6qF!HmkQ\seL!XIK..S f1P+qRܱkS6%;kׄU/s~u#fkC&J2Dp+r·]Kq|KKm'6B2XkD<ŀY,x!+(&|%!)-nΙ:[b,@HQ|Y+\#cqRMky$d="[0d(ș_ -(ӝ12M<#j,5 T[rK4q,y<> 7eƿs a빎% ׬u1@/&>֩Q`T¸:b:)ڙ)W5Wp/W>dp< K˂Y5I"@Oxh,x9rbdJ* eYJ@Ss$oj9k ؋fW]K<1]XD1L(@Ф$KtT;TYBQHAȗ PhwbSkZtDռU[  K%`ۀ#+CaGuy|`bfKkT|eS?UorVnpWI#Þ HW)HbDy$bFӴ, sm\Q){ƒ+0[[bBP:12;k3L9TXiwKt> SL2b}#+9&2d=s7Ws52!05(/DoB0 \ T'xيvALBa+tyò88FF!2)/)Xn'u2A^"͊]*@9&K  9c8*iQAldX6bQXByoIW A+atu}P;'!w?s74g{p9|f)윞ǜxs|ˣŜC~pkNP^D~scͼ {&6|{ǁ9x~?@GG;G^)x#/m6CHG=i4c8O䛱ה6#plxGd4|Xor5N>0r5h蟢|CSo͙?iiyϸg g ' k6xN3~c~6y? 5x}> >L~mVifi`? endstream endobj 4 0 obj << /Type /XObject /Subtype /Form /FormType 1 /Filter /FlateDecode /BBox [0.000000 0.000000 595.276000 76.535433] /Matrix [1 0 0 1 0 0] /Resources << /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] /Font << /F2 5 0 R /F1 3 0 R >> /XObject << /I0 17 0 R >> >> /Length 194 >> stream x? 1 oԥM[?xM<CtoTtQMC~!WXK84\2CFlIOط(bQ 0)|vVNjT ձx%;Uap޸cwa endstream endobj 2 0 obj << /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] /Font << /F1 3 0 R /F2 5 0 R /F3 7 0 R >> /XObject << /XT4 4 0 R /I0 17 0 R /I1 19 0 R >> >> endobj 6 0 obj <> /H /I>> endobj 8 0 obj <> /H /I>> endobj 9 0 obj <> /H /I>> endobj 10 0 obj <> /H /I>> endobj 11 0 obj <> /H /I>> endobj 12 0 obj <> /H /I>> endobj 20 0 obj << /Title (Tailored AFM probes created via 3-D direct laser writing) /Subject (Tailored AFM probes created via 3-D direct laser writing) /Creator (Science X Network) /Producer (TCPDF 6.2.25 \(http://www.tcpdf.org\)) /CreationDate (D:20190626170359-04'00') /ModDate (D:20190626170359-04'00') /Trapped /False >> endobj 21 0 obj << /Type /Metadata /Subtype /XML /Length 4353 >> stream application/pdf Tailored AFM probes created via 3-D direct laser writing Tailored AFM probes created via 3-D direct laser writing 2019-06-26T17:03:59-04:00 Science X Network 2019-06-26T17:03:59-04:00 2019-06-26T17:03:59-04:00 TCPDF 6.2.25 (http://www.tcpdf.org) uuid:553400e5-4bc8-be4a-e432-9d14d2663f28 uuid:553400e5-4bc8-be4a-e432-9d14d2663f28 http://ns.adobe.com/pdf/1.3/ pdf Adobe PDF Schema http://ns.adobe.com/xap/1.0/mm/ xmpMM XMP Media Management Schema internal UUID based identifier for specific incarnation of a document InstanceID URI http://www.aiim.org/pdfa/ns/id/ pdfaid PDF/A ID Schema internal Part of PDF/A standard part Integer internal Amendment of PDF/A standard amd Text internal Conformance level of PDF/A standard conformance Text endstream endobj 22 0 obj << /Type /Catalog /Version /1.7 /Pages 1 0 R /Names << >> /ViewerPreferences << /Direction /L2R >> /PageLayout /SinglePage /PageMode /UseNone /OpenAction [13 0 R /FitH null] /Metadata 21 0 R >> endobj xref 0 23 0000000000 65535 f 0000006018 00000 n 0000250416 00000 n 0000006085 00000 n 0000249918 00000 n 0000006191 00000 n 0000250573 00000 n 0000006302 00000 n 0000250825 00000 n 0000251069 00000 n 0000251308 00000 n 0000251547 00000 n 0000251814 00000 n 0000000015 00000 n 0000000485 00000 n 0000003353 00000 n 0000003850 00000 n 0000006416 00000 n 0000094428 00000 n 0000097120 00000 n 0000252032 00000 n 0000252530 00000 n 0000256966 00000 n trailer << /Size 23 /Root 22 0 R /Info 20 0 R /ID [ <553400e54bc8be4ae4329d14d2663f28> <553400e54bc8be4ae4329d14d2663f28> ] >> startxref 257176 %%EOF