%PDF-1.7 % 12 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190617014405-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 13 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 6 0 R 7 0 R 9 0 R ] /PZ 1 >> endobj 13 0 obj <> stream x\msH_1ŧP4zlU#6a"9b4Rw{^l8\$e}/J|!kϿ~3r %4|Cfsف ~WCIyaĢ8!yup#Ϛ{߁qj el}}[ ( g”3K=o"?M$β $A,e~Ubfajk+4JC/d@w2̧0IBF K=F|(J`I{){WS 1,b_ͼ5YQ T4HKQNDeY6kR|kf%N EGc/5.y>#h?&eP;0@SY&BOv+<"*M.K1.[Jg{葦g-ĕ(*,l׹^V.ػ [Te@1K#y5HܔݧגSŵBMe3p(ECZB`mNG:z|ajzU \:9;@BPt>/.iKzi5Vd)]sRr-Ww"_Wb_1Au}RWKBm8ӃRl@R,d- l i CB"/.U8PVd}'rNJ&w{x!MO 2T(N%ȼ!dۍO $|3Q) %ȱ2пat³ lz͛,ȥm(<k5;Df%q.,V36eۦ"zR6 f+ɶZzU EWSmiCtpQFO%omA 7p#^-)xǑn?(51Uu#I7_}ו< &f",eȡRjM׀ Rh ǫVMq}tAֶ߭vm\N3US记|TjukHdeXhϵ󯥕G^- JSGa5qD{e8cKX897T'YfH5߀6z7w0C4ud޷X+l,ܢڝo VPƆk\?:77|1;]5(搟v0copk ` e۹JbעYHo? [6'X, \c-=8 BreHK7()zj}KCHzZ˶-'Q?g}yt ץ h=0 !q.z*ǍP#|imοݳa˾Gk' Pص%d\\ (*IۅD&G춥8 nB(Gw ݭ@:ãm,5惯g؃zsAV ~|F, MV Yn@ p66y bpKs2-HSm]v%jz{X.4ۃ(2X>7rMO{l 9k^ȖkďH4?>'O/ = HbñI&0$ދU&>^D( ?u|t} ׮ +q|, [|z^/4G45^K,HemD#!h>S>a_(ўtO*>fI=;v ŌK(!K8%9D^gY %$xBmU3 endstream endobj 14 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20190617014405-04'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 15 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 10 0 R 11 0 R ] /PZ 1 >> endobj 15 0 obj <> stream xVO0~_q q i0 x5qpFwqi)-ҹjk>;RlK-@I:?S \P )K2۷ r* 8σj4pF?nw Bp2/< 16~[׏vBxev a=tnXѵxp8AIGgWgIS&Rm iiU`Fz&+Qnu׿9F.Z.Ъ[H.0?1'o?QNG9ㅜ1M{:7%JOƵ C=uYהzևr6`q9_ Pl]ra\Q8^SwzRlɪ\eݠ`EfT3rRg͐6zE*5"z`JM P4ZR#0|8-=Z->4 I8PT-*Ý@> endobj 3 0 obj <> endobj 5 0 obj <> endobj 8 0 obj <> endobj 16 0 obj <> stream JFIF,,ExifMM*nv(1~QQ.#Q.#Paint.NET v3.5.11Photoshop ICC profile XICC_PROFILE HLinomntrRGB XYZ  1acspMSFTIEC sRGB-HP cprtP3desclwtptbkptrXYZgXYZ,bXYZ@dmndTpdmddvuedLview$lumimeas $tech0 rTRC< gTRC< bTRC< textCopyright (c) 1998 Hewlett-Packard CompanydescsRGB IEC61966-2.1sRGB IEC61966-2.1XYZ QXYZ XYZ o8XYZ bXYZ $descIEC http://www.iec.chIEC http://www.iec.chdesc.IEC 61966-2.1 Default RGB colour space - sRGB.IEC 61966-2.1 Default RGB colour space - sRGBdesc,Reference Viewing Condition in IEC61966-2.1,Reference Viewing Condition in IEC61966-2.1view_. \XYZ L VPWmeassig CRT curv #(-27;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)KmCCj(" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((p <'IyPHM=xGYvE׾0O֠tmhkEW2ZF1VU{V8t|Z5/3^ԖVZl)ȮǪ^jnӓwְ~bh{Kj|5Q\EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPQ\\AiWSEmmm$0[ 4M42QFI#*"+30PMK_ 7zw/|&5%MO㏌tqb{.mkdK7 kwGXL3TӊMн-U*JIiN*Cl>Qxԩ7ɇ_[::j JR%qPtߍa<gE|D2K㿌ƣwΟ 4kk=6 gi9-eӬGmt_AsS֡l R(l>uafaLƄӿ5,f" >ZI=wMhFr쾼\+`p jϵ %1׿KQ222ů跚}]tohV7")Q4' #G^<_<+}/Y؇f?I/a+; mJ$6Xcx7M3^A~??jo6ÿ<-p&{H{R{4^Iռ- 7<1"cvnY-O)hlmI=UN0f1KxbFz?u~S:ξ 7N/zZ䎲*2:GB]X  AqNk?~?H<o_~fG~Zg-ÝZ}Yv,zl]sw?_~o;,s$v\^J^ZpVѵ;kMWJk-F"_71ʥ1Xj2pF*yF:[Iԡ:mUa1)PJx\e8Ui˖*GaܴUiڅXөx/L+;Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((-g}1~Mڳh6ռ^ZNa<7k[hZ a"6/N.tB+~m-+Ǻ)~&\%>e54ovVZߌ,*>>[Wп7^C01RUeO+j^8$^DK4vе~ !ŨUN`¿m/JC]kƩiT xuVP^1iUm5<%E*+HU&-|:qE +S+',6.A8uԪPBUhTV1inhU.z5Tɦ^%*u`:π~_ / |7;;g|G_i}^wt)|; ߇[[N4/scqiwqu>|Mֿkk@յpML~:Di/xt+y?78osFm{Cu]YuKK[;#fc^ x*Qԫa+4)$*ҋ#Nࣞ*Ҝ|6񧇒h;ˑR;qkMúu#Lд4z=Z8YYE00D=+NcORy}Iy&(wv1x,!E+c$#O//ھ8? t({^~/2L^o>oU32Oُ _h?QI[~К%_#bҠu<3\i>3V.C~ΟdO{'h_ .Mnmc4]SleJмTmc7+ Wӯ"Vut cW*7,olNY>Tk*܎3 B=a̻GO YqE+V0# 8 AK_?d~z>|LOZhė/'H$aⶹ4"jԾH-Ϭx7,@m/-5 h,.m'+iYS:@ee<+УF6&8,|V/|gQj2 ͬ6F|̑]S,'$y|\6YqŎ ӵvqUVcLhKkB~-\u`xV?9J+$4^I{jq5\-{٤/-I,gr{\~f]8OkI' wXɕV޾!]>PGʪ >Q_1ٳ{#]O"]7zq>urܯVYo| OU:_,={Anڷ^?٠TU*p o(Z|/PcG˻>.!jr''M}vgkچ!?gѼ~>$hm9g>Ɇm|E_QN? xۧ¿?A=>񿃵Kyܠ ]!C\K V:嘅<%X\E4+Z,:u'x\GR*cܘO^YFQ/l;NqX5(EuY]Uѕ2*  AȧWdj?Y5os Ʒs4xOM/kFB5mG$][_y,;L^6oɳ2ye_䧆|{]yDiL_D>?K Nb瞫zs]/|N{jT+AS}?~[_?Ɗ |=?oGuow8|sm؅#M刀C,O⾗?t?[Oq|B𗇵ŗo͍⩃1cb<3̒o6F+aV& Jk͝LE*u[teoH߲gH̨U1@I'rkm Ak~5;Eֹ;T䪿`)/r|'ĝGNsnc^6$3xL^UF|~%%Ojɳ汼!xW+U-U'zj{|(ĵxPӒ5}4NdVQ#PsO>ZZ>IRͣi3䗴6HM##0 U2#Mq)t Msޙ mV;]L6o":YkZ'g̵kZy]֒Z5ug(xkJ񆃨xwYWJw0zzӵTMRإޗYYGsm[UJ61B崋'O,-"Yokv߇:,u{-z6mKLI`8_RѮZ7J k-;asog}J[7i'J2P,S[ۖ_ލێ/렢,i,l9dאXFR4Ȱ((kR|ET^qSiLq*ݳ_-*v4ا˜Zď> xR?/9huY!8BX1qMt+.E RoՍ-UoW$~~v¯Vw&8.6#{~)i^:`̶v"MD[;56)WJmv8kubC~kj9{OƘ$8<y۬OUNZ8U(EumUQEEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEi2N/_x?WMH<5i=ǧ⏌𖸭H|?y\AZ܋S 0Of]¾a`ʳiF*(SYB'jsNn0n;'όSa18ʪrԍ4:Rj R\bTݯ$?R _u:w?5 N8 _d?W"NE@ٯqtWF_X/:; Κ GSQW;!¼ս.Iȿ5On?Ί0 GSS4jm2@:bSB7—A^+܇ s"NE@ٯq4WKoxrxyӧVj%SvMϚx|[0FPtu 1N/ީJ]+$+woE̍"FD/ş^3Ggk?:3? E?c~#_/5?ڏ/n<?|'ӭ]ER<+i|=L rNoO tHW$*`AubzSj$2G/FeQ֣FҥJue(b*I{iZj(;>((7?ୱ΢"OvO߄_'[x' o/dh/ş^3!9L+A?ਿ>LoB><=REOze7|=q6^'.<]޼\>(đ IV. r x<˰٦ |V.5!(NTҫ$VHJ%)E>Î2[QEK Fq87p%EgNuf?"F? E?c~#^A~, 8#?3|?5E(_o_xþ#?~!| g?:e{/>z~cPj/4vfgK[(= 0ήUF)BUR:V*QNRɸE{>)p 9N5bV˖Pj2&%_P+=  wh_7W[񎓢 %/Ik]+Vmi!_i7m?54d_ s\x^0kf. SK B U8ӂo[.i.imݽ'K % 8zSVoœ\ݖv얬3? E?c~#GDn1 gdWq>΢"OvO߄_k Kq~fuOA_w7R>ݩSol$5MXi4RJ_ OKq >JQJN_c馦|AqP*VRB8|=R!׻HA*8Q(i.8a;"iEIH.a3Q~2A'{W :h '  7.fshYRCt joxMKže`I3!em繟OA|B[c%~.UW$l9ãi$drk\\10o5ijӼMD\g9U8e.L-)Ux|?'Ν|ǿJQğN[h>M8urkdeYiivYevIYw%ؒYI9^Sr<ɿ,m I~VE4W$Kȡ'Y"OFIu=I_/|r׌x$K x[C=8`zW ib[g?Hl}N׍.~,h݆- ^4ѣU'1s;0RxtX|~Wת:x_Yʱ4WCKJ<2s/SeK: 54h/~|C^Y(<ԷŖ7!7C_NI+⎦OixVS$+ټ9rivZjZs/|s䐝lFY,^r8o)ӂXpKW:xA-壷_fr:XЭ-d~6ьɽaVRod~W/_ODŽ|Gg|_/t}#M//nl"Wy Aom"J,NG",Idtu%YHee$0 A(O;G>Z_5< >|Þ*/MCW׼!MkQw@͇QE7#ޗ-d}<bq`X~2{aTٹ֩9BTRZpQw=<&΍bq5$ap֯4b墌#ʥY)Br?' mC-&xgÖ4stR>[M}y_6|-`p?g"OXHf6Kl3^ YFg];ÛiP]O' ?b ?f'-u$[wآvw?Qx;ZOWzݯ8.G|3k}C>?4MKK{KxZ%ީsk㿉nk{i0y^K{kE2jީr^WCo r_^M#[@aO"]+Ԕ0n**R8TܪR9Tgjxl- hFtpS ^BjM-YI10T]jI .?V}83_k:V 7_|c[R/xoG%'<54YAᛤִWF4MkEZB"KYX Wuiy`JK)"H XHݥ.~~76?j_д˸IiĿ.q,>Z-+SEMk×2j7)8F6k8 /VsZQb'ůUZe|8W^ YRQc14+ OѥNփ*?qM?|?59LPz~$5o[91_6 #LIe𷈾xˁu-OAd-gsZOse"洚o7V澃MzN+SVUTVyX48vh)󃅶l= 1cקOoqӊo"}?P~~+4a>#}^3=OHot#r:cmz>Ƥ(L~Mm~[Cߍ MHMÿ\Z8nu UGO;ﵖUGYwp52RVNnUEäZ=p{ /h?Bꬩo|N[#_|<ף)xXYa/-$"Kk-;)H>6ݹH_ixOkmg ZY2^$䕘37OG/¿|^!Q;!wg/ڻg |G4. QhoS\<2CxmBͷ eUfN?4[Gթ ߊS]K "]}KZȵf0\cIKL$lq2[2^xlEG ?SQUn֩R/,8pZU5:NaEWQ@Wϟ?i߄czۼI `-O2]5t6L24sjv+2nkQpR8z5+UЧ)[v*+v3V:gp[N]薯 ;W_{_4X/nbO*c޸sD(Ws_^7~)x9woOj6oۥi_ >P/fU" "aZ?_ $TVJLE X\t3Q^!OmG'#_E{˛i'2J>kkR_.?dQ_.Ǟtź Ǐ-oYLt l 8q> %xOm;zm$ݪgVdImܵ#oR'om/3z\EZiƢ^~GE~z|"|5񌶺G}6"]Qm[Spo5@2n5p 6P;;POmsnC<2) ;Xlf_z[+N%HSɵdzaQV5-%AQIj(#(_/][~jnڇ4E?Ԭ?n#z\Xp_Rս>|?ếj(Ofv~;YG @SmCЃ/+5_ޗ?woC t_( H?E#|zغZUA(*~.Y|KoeI5 ޮd2ϣGck}_ڵ^Rab8S9%F!-_R&^,/u'I\[KCH/uxJ6J,iWRoi,ZtToL8a {zt*u!:u (N.(&IeJ%x-J-wM]5QEAAEjV]a6]XYzk"1 "HmmI$7d-[z$FwynZ-Nm]I.XikwյuY-u)c`o?n_/Jx3;K`uKUI.ߣpm M*R΢}HN#:n*r%ҊR`# [J;o5=>чUYEWy{۹i|khO.MvFV nɷZI-`JR/W_D /{c}gX]Ł-ַ1dyNʙ29-#8h?ɔ%MyhKV7׺e힥iuo}acq-=VȒ*$?O!W~ oO?"͇ $v̑ëNbX?5Y ֩g/Ɣ# GЃ_?Ĝ5F_Sы|x\\c5֡QKRo֊o[&α&.FmM4V;m~IMh4C~WnK@K|lX~|Hԯ ƭ}.MwEi.'t}[RKg~61_#)b<&N197\`jf*8ߖ|n-¬/gSqMGU^#mSUynhJsӚ9Nh6Z( _nw΍l<&>_j*:o0o>?,AQE@Q@wW?7jV.&эUl'QL?b} zxx<5߄ZDO \rT'+Ѧ&#͑)Oxw] xI|MmkT=NԴmwDLB@$ӵ [;xde5BG5s пloecQ5ŕ|zlMZIXmĿ Ge5h5 #&cUKPή//zCN?4!"J9?`&,6sBBekT欜WmFE~>}(~4h^:Wtdk?Vt .ޱT<^FU^_OßuE| K~IqJլ$y>o жl] nl/_޿o$3|\^|#Nf>"j?oW*4;ttnj=|FS%Gʵ_JOv\R0Wu[[*+QǧVoH.PRMFVhf?i >:K?j^ >bYϾWM6 x.<qYw8ҮcI` l'UOأQL {SG7Dѕa KYX],MWx⇎g+Zψ|k^ 񯋵Y/5[o\ u{srQU@wy+qC,O r^YY-,U9E#gW(qWĤw{jBqzH䨢? @_5 W{D7ğJ? ܥ~ڒu(?Zzk.Ew +Uծ&7I(x㾃ڑwXW? ky-H\*"^hQξD2 _⧁4÷  ^tQលa'[P*xo: ˴klX|/> d1i_,[`YMVXt鉰}R(2]߃<چ:+%ּGk SZ[mV.AecAii6VߟS?i7mCӾ!oq[IxCIT鑌Wn"H`pTک׵}=΋/#Wþs^64MEhT /uۂܹoʿ ?߲?3@.t/ߴ7O~"u^ S@IhZ&owI5֝sWVGM;YcO:YV#, G\Ja,<%|B J_#-hx6Jŝ&a ?<㵂$DEĄyzlٳo&߳_|@hIx“0,v""|v$Uۆ, o~5į6~#|"A|UnAmA*g]нŅڨN5b *pj.`5KںU:Vs:˳^]NQIԡ?sFmsΜ֊(=SS.#>3.}Uss?7{mF_u)# z;U~߷Bnj4O kR54WZ&5}gJY'УIo7$^1]"RKmWžd?=eC?g}/'m"?Kk, |Q'SISL>uٞ%Z[RIeOǯc[FuJJңOJt{4`ÞkʲѶ?^a< +T࢞'9'5k'.Y/ ?d߃c6O^/Yb0ݶ:u |3ỘdU&Ds*~Uk+;M:O`$$c!DUHEDP _y:gbߖXhsrǢI$?wapt ..ֺN4ԟnzQ\'HR$$I'{5^lRoꖒI/cm$Cn݅ƢI*$5v](i)SW*q=IyE;%u''y#:6s E9l_-n/_Fi|Aجl.jWpؙG8zJ4j8+CUu]JCG˻ӵ[+>LgeŝpB9$jYԚi4M&4M5Ml֍Y}j/?uHa=}_Z̟`u=ދ3 YŲ5Ѵ|EcPѝ M(V5iBjɧdԢLҕj*F)]OOwMhB|.iD_iPj:F#]i:[_17h+I,-%Jpf?~dK3!5HƎeOCq}3[jniޏy6l,/KK_" >gbRL%{QJRsE8$~,#whקeV g},WGo=^1_??qc{^0X.'oʙE)E8{L :l&*<;ȥY1Z9'h ^+r1LHufmт%ƛt_^:u~*~&gztk ĵbc[wG:d$ٸ7$R^}pӜ!AʅTUG=ɩGNh3 *Rxy*oHEtwvEUԬ5㺲$xD=Ձ[#2*c'*tۆ.тu-wGKJEW@QEQOX|G|uڬS(~wOx:4u;[q dy "<S9pI|0/H'"9F yIEz~gÿ1ys& i3op];Ir!˳QE~ RrRu%T/Y,2P`TWRKAETQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3~OK~>7|]Zt?0x}n_=J/3W_{/ԺG{W|oҾO߃>.xf[SV%76wlʹtK?S-ŝHERVHVVN)ʝHIm(N J2]ZgJp ST5iBT$ROV? ?OΣ2r\ .u2оu|;ԵjLucTs_iV.ửXw+kL1_CQfQyX7KeTӿ5|>3|ג9 u?*4h n 'w*ۻO+onXE[㭍\c!IW} oT=pG#)b<&1xP'5\M[urxZk#|-i2kӣ(4QE~~p)_~ &럇> 6?3ᚿ4,Š۹} xƿ:[H|aS3P}Q_ȇQE*s_ƪb>o^~GxQEh!x# ʾUd_gE?"C⏇wj !Oזe-wIWWbe]}Pb08X-GKGBwZ5UJr]z5M3t)bpׂFFҧR,b޻֧x(s/|>{Ě ҤhqxV(5Ù"pX)֤&h>7g:|-i9*+/w*5Nm[ђUt鸹%uGx ~ڿhy>\/:I#k_ |Z?"d_]އo*'4-n Q^3 CPU0غp鿷J%Nn2v}X|E\."&+aӭJ_RҺ?ڇK4oLӵS5{ MSKԬfK-CN-㻱)n{yfXGF*%vkjo' kڧ۾#~wʼnZ3wj*S['GIF# CmN=%(Oqg'ZO⟉_ `jŴ?6~5Gi?usʌxcZ-[]}\an)z׷~ҟ]NAV_ojPxJ{7@g4c1QB^#_\)܃.ʡJ#<\㯵*kJQ{ҍ8^G{8q%Z4"a#nJvJrݰ@@Po{ Jow]F,qZ0픗':ti}~]^8I)6Y8<6 \EiP&+(ӂsbhakcqX|&<5aFzsNJ)o9=#LA?_O,Vfេxo:L~b?=AD4[-6uX~-], S7T ^b/{P15)Y?+ -.L,t7NxlllK{K;;X8-m8mD#ApݯaK|! bs? x~pS9U_Y?ZNa6(qO B ,)Ҍ%'ltn pB%4J7eZS䯣#֢+$+''g~/ًN<5Uu?x.|1zM<_YE:iZtG9,Gz#g& a_(OMşoA_}F_y{a~& S)u{:PNsڸ9.kW+*<< #93t)IPߕC S2SIC<^8IQu"sM5-?ыliw4 ~is鶐[>|c'_$[xĶZ繛̹6oYI4i:fgτZF O_ÍFhoȈ0cB1ox' MH %Oƿ׉l>|,VnCco/'1J2p ;Z ~ʺ75Iy:¿3س4/ U/5yApyi3 㷰/GUQkiV1e˰UZ}iH 5_'7uKa௏"gپ Úg$Uva K$K/w 8c+w<[Ɵ+Wn5kؼ9k=X/4?o3wVFWֈIiZ[4n$β晃a"#Q7F3)ε(BUi~Ѫu!hpMa,=wJtm $8J4)(NN唗+normSŸM<ؿ>/^.:xGdPˮkHʾsƛ|-'U+LcOt|~mݕ/Q\[Mѷ#޾jGR~~/kO Uƌww. mi=B`)v6|g 7ѼE$I%IWUӯ%xuo..Stݮnd{;0\5XkW&q1ZiQ%q8LU&/畡+8Ui7ׂ'GBvГQE|Q@g_~_|2mօxk_i@HtSD\Α]ZM0̟wr5~~*>)|;n/Mcݤ]D^ jC%-kݽZYůu\xWpg|+^\J`uxU))BQvUhԥWn/r =cΕ""P^#8_?&#JTMv2,>x{s[aĺ[}˵d4[^\L[$.; }~_Ǟ~ K¿w_> ^4[JW4qnYx÷>|x.oh6D_« EoKiL6 #O'Ú42Vr[}M#+^Q%(I82q^QviSRJQwRIiPW|z_-ZRG FU}~?x',[s2~or}@M矨?=7T=KEYoWIm.4OLlf{k B(nm.# [h)QYGyniaUXz\V*8xFU)s-!\|r=f7p6 ,E6CJMBvTkTSwJ\bC a,Et^gͬ| m$&x,Mq62SZUzO./'!mׄ|{Vӈ]"RO֡[Ά?k>Xg23]hΙ-:EΛ:uc隍X]Eť\[OM "+jo[?-CX|*ß jz6vI[7گ}:59]]2k MҎ}qcexaq+,sTKhQԕl-J1U(JΥ; S(+rhc› jSu'NT*|m/%f$I$Iy$Mkic$kvUfI>&O$YG 隭ƺI庆? oσ_ 5P񏇼 -*=ʷzu;m*3*H-,!n5}77,4x3;~ ~>X@K3òKI?I~0u J_^%NȮIb,H/ rd*[O%ד}}*Sxsx{xŞ=^Ѯ/ nDZvmOQO)3_|MxĚAt׺׈uK_RlKy%%xSۤPFqR>g)7ucRD6XK)(;jNiGΤT?)S1/ ;Ql*5]G5C8xOWLWGo=^7|OV}Q_*Q3D صֿ"Zпk_?NJhM/4:HJV2X G |MWFƃxSfJa^-u $ڗ1+G ^ZJw4WX%XUiA{tQ{88]4>U֧RWZ5fUUc%|'}Z}jv,yapd‰d-Qx9:_]VvߏȨWWho&1Q¼ȱO'B+Hr\%~߂X<&&KX5 ҊJ8ͥiyb)8SV4Bn);-B(01JNmOF3ӧ/ N2ٜMQ_.$QK<RM4$P4,8w܅DPYPI'{/zƯإ՗Ώ['#9-x öŵ.$u ty20uuW2RNЦzg)Y 3N4s~ iyZ7,y]v6>)}[]$WV$H5x#%[ȸt$pyx;A>i>HB_Ϥ[f/#w/Xn%Mz?:s U5#Ml=)J/޷TeL$RJ2ެRO3^G>DqECpƣ HED@ }iԴ7PVH")kJi6tydi[&|o폄|myK8/8瞼ן蟲? xA߆<6xwP]N:6iiXdijeD~hc(C'BpUJN2M4byINXz.QjQ%$MK首Q\EPEPEPEPEP_qOh5_qOh5<#%W 'Ն8DYD}Q_0W)wE<ܟccoGK_|5WNo XXmM pyfQapԹi^*TJRq4FMO^615a z唹)RSIrJr[c);Y&?>-0M7}Mo^[}/m䶋;KP4[_0cԠ'̴ۇ:ZJo4wB˔|*㚵! M'ZctSTquj.g58! J9O 痔]J}cԞ?g\|C"'yEq]#z.l̴ž1] g] "!j>*П|S_C'W/|I^}R'X+M;Lӭ"HѴk-#Fmt*?1^C}VW׊q\UysTtӊnIJP1WCK<+NJRNPJjJ2m$EWӞ!% |o)<~-_>FD -_w~uow}^N7iWwɵ}?P)zߴt~^#5_ Cy4ys(xnj|E@j:4=_#)b<&if_pJ9} fYNiJX\,BVSVnl~<UbSS ZQªWRk=Z(ޏʂ"_K+3'ğW>ey9%JUa &ՅjvM+TJF1eXx E%QBRjE*93N.Z.?G__Qq?j/*+ObKAT?E(ѫп:o?.?G__WEE x'1_p_&%O6ie$8ŀ>5WGQ@D/ء3YW_\be]}T%OJgm?|v~^e?k? \E}~3x?COM4iW[WiMfH/kMsC=mn!JQ:|;Qx'᷆>5YuOw2xź- &N/_g< =xB/F3bk˛|uh*q9.pe5*{,/tMFԜQqEW~ghj~'x^[Z2T;jGݦ;c?h| 7O$n P\3|D2h"Xn>.Ԭɤ0P*FUUPUT~ 7rSpWsNW48UH4?U%l4>uڶ" _ʲ#L>~8~ld S6ogѬ{>v^>rrךQhigkjW!^EkkIX] _4RZl/n` ?ʳwJ5#h/ab\\w^Դ1.+Pa+C҅jhT4Evi4hhB\>"W9SNj҄_WMYL(2>?oo.Q?uؾ|/0>oEVׁ)+}hBZ8.b kg~[-;~|l[N|| nt+X4 xzLO8Oh͸O3JyO֖*n*ZY_CKuZ]_bQ4*jJ*m zq|Q{-;ⵧ?W<|oR_cwKbKOZ,1d*bt>`mէGF|H(v YS~G^n5k-S_t񎏽"E64 SjZ%ܢTGL}& jʄ9b%Rξ  X+:NjIgN8Xpr]HќT4:;)h_&)z_cykQm<5ֻI?m|2Ak_k:Η.mD,QuPXx=2* lW YNզ(TCBn"VJ;ӄSPzjIJtRX7jեQJQvmY(#(\BsdH:]4lR{`YldzzvM_4  ,Z:ĿWW5vS|?UXՎZ;)k5cN][oOXۙ5o:X̸>z@t-b\!Ȋ9 {QױWGc>xDz*p5n?Hϋc'esv.ZWxO 'ItkRGa]8&sN? XP2Zjvi^~MB!|* d1x/yof4mN_Rɋ^J>P*OsMx{F:PNJʚ/+îb4!O3im1qBFeaΠֺSk}ugWM__AI0om* T8U4EUTPG_P j,y;?Ŀ <mH]e*mt׼Ivd;.e_Ű\ͭW0\DM,2M̒G$l+2dfjڙfdg ϛbx}r{^p*韙=q M-j6kwmwAeC9>>q^;=1=F6Vr~y!P=9"K/#u9A⾓ I&տm6͞EjO{._ꚹtyDVF#$qƥ*źO'/$u}]y6[#uW 䢼yI?cE6r鶲2<"1V#nF~nU}F[IBJVZ.?Q(MtOun?{?_}㹇zp|iyG|?8_o{?m}J~ {ڳd-[ ),O,3RO>cy9lk«UNIԒJ'FN=Ҟ_SԅiӕJ^0|kߍE%M(>f]0j'?BxUf?Ư_៌\gO}xLc9l 4Ok_' VC/5>_u3_0IOǫ*ho]$օZj6ƟZ,+5G#0G|ndZM[_u;Cޠiz[~̷M&TXkFݵ:'m3Fռ1})t/h7DkEmUYF\=zU(ףRTҫ B:8I)FqjQi4ՙ:SZSJU#ө )Bpe+FIvh(ȳ 37վ;hW-9U-f\vym/to`C~mk>(đ߇lvUHNc޾XrjjSAoU)Ƥinx\HHI~AEWq?Lϋ)xM#ú xR.fx<zdYx~o^dܭ$E:Ӛ*:7=88zWgd˰&۫;/QEO텠fCסle~sѹbEWŻ&~;g?@= ^n;Qh^bF_GEWS\gsowm#Csk!|rYτ Il'8'y5C8xOWOcKjnפ+VϦg/ _qQE}!_?OZk\,,]_+k[Y[+^` 3˰5 ǖ9'_/Ĺ>/78WF.9iTTyya;Mg(ʻ5QSQqR\{?̭Sox_|3xڭsywpKkk!.8aFw ~2FȚf bdCt"Gmq_{ȯ>!xX+[3=ԱVR8*XZi6RKke U*n ʬ~Ӣs2JuTB 3zc֭8u)UFh'VWۙn3ϊ|cM#,^EdJy #]UCuEE:pN*qJEF+S)NN򜜤YIͻWڿGys=?m6|; oyCX@GTgW|g)m q&aT֧FI%}?^MGMjJZW>jivrK/ .Lz@Hh+k/ٓDZ!*ڍl28;OK{wG88$ HƊ0QTv ;_etԯZKΔizg4犫0MzMRi}Q_VQ_,H> |*?xhcO7kUJ.l f|BPF Ы^bJrPN1ri&(kZԨENHR䢜m+M&SQ_g/ k=G<r?з'F8 #~ՙn4>P4ωu{ KK\۽q;JV̲(y!,GrbpVSNQXJQNͤҺ7^tF*7 )${;uQEjQEQEQEQEj_ |֊S_j_ |֊S_C?UpXa#?Eث0JE3Q@Q@W| i/k[߳.Vf'{Ldb5K6?hο5>2r^b*ҡJ ZqN 7yNiƝ*sRNѧNF1NM$x~;|l't_ÿO-v玶\X]YoIkK/u+ ~ sGxcLֿZ?jKC m1_ um_:BfN$𽋺y76e3?^5_ ~}_߇Gxcӡ4m&6iCo5ē^:Ϩj֣]]_]\\Ka3X¬eJy-p$6bm)mT%f~< VΩ<> T -Y5 7;UNR: t~4{BmaҴ]FNt2ROӬ-`DU@#aO>?5p<>Ÿ(|j¶YLnmo,6zޭϷ㔗 $x$VI,v%GEWQ_O ,K>~~'_zv>|2 |[xn[ 5b<wgŴKhFeWR aV*1)ZZ!hߩ뢻= -X 'UGk.HZ9Ti[݋~Ec C?OO?(V?3t΢ #6i+V</)tTW.+Lj:~ QGBçua?ޗ?qlU[:**YE<Ѯv, sTUEP@> (xkLU!D/ء3YW__U?Srҙ[Ot%|dfO_G(M⟄/tkMXۭDžQjj NT>/X tymql>Ɖ#\Eyo^%'¿Ͻ^ u2͍SYcΑz#:ũ3\6Is\dPi*V*0oOi^F{qGn]p :\MXӋjzΤ)AJ,]K )o 3ǯ-WER ( $:"ZxY5x!s,VqsLd8DzǙ}U:0QJ?f#G.8xR(w|ޜI9No'(γۋGDx@Y|sᶽu BC%Cn5M"QGmj o7{/u-W6KO+n :Z~ɨx[xYo5o79ok۵=OFi?qE} q{*Cnu2_4sI(S RZ^ZUG-b!*ǖ[/5bӅh-ҝH]smseqqgyo=ݤ]Z$HOoq<2G,R*PW_Mk77_OF|o7#m?X pi5-Q|~~Пi}ߴod|`l ^|>֧O]BIGr[۲xkΆ7()S--l2]qg8w)` kኗիZu^VKgh2@o_ h̚xD/ؓ'̼<#_mMi_*J/oƟٯ5߂_jK$Vv< ?b5޵ZYkVAtn/-eL.[9pfmɫ*8rܕxi!3L1XdQd)j77 5ٳ '࿅|2OLETIIuӨ|4 h)'7|Fq-G;_KukyZGSxF5x:ׂ0|'"MqkcV >:ޑ-V͕u7 9ÿ'æng|Pgx7?jzFZxt |<= xx>E,>"? O-ԅ:9WnMhէ:j'RyD _n=RUf4^ڍO_vYt? [""K]KwP\i:GkR?$(( 8`4bE(BGQT8DPTP_*;xŗC_iiV^.vD"sՍψ"յMUpjQKiNy'7\JN18]i&Qj1ڻImᶑ?ğ~#x# yOzlzCӦԇ)E#|K /|!V+jl$$IehzƗ8mg(rJKz??Ş%Ӭo>_IxŰׯ]Vp=)ү|/<_5o-k1;w U0BWě/|Oԧm5i:Nr x\rdY+ x y1ﰘL6i48O,T_9}R|_ %8MsMNT$ӏ:]KI.w[|5Α 29+TSh"~&O3|L'g :1Ԏ_CjW8ڣtl\zke1/u.ZNvY^VMom}2#yf^:Zw0 ビO9F4???6fgǷ&V㼿1_k]9x\~u_2.XinKfQm=J|xŶ0旡xSTTmO5': ҍҥHYಿog?j(|WKź6e׼iz~9oot̛m3?5#jdx_"7[e P \藖4;FO ]hvVjMk-6rCrJ__U?G[߶^ %\Ii:m=>;Xy߇tum-A줸ӭشJpQCS5U &aڍ L竀s\MT ^f)fi5S0N.e*я SOHR6')_> 9OWų?u˽CW<O ׾/L5>?xO_<[^F,QyI7~|/.we۽|6ږuqcȡ_Z/t7¾<;&B4=E]vZm0U (!n;#;="Y..mnYry 8\eXbʾib1SSUQQ9RHEFa҅EFӓIt:r,uRHB">V4RsrfҴ/?௏?'i~ @|) ;_|shVW~AwqY[at E]SIkmJM4H,↓< ^Z7>xC'|Y5RMk{i:A1\[N]G=vfž ik(ti$Z,]{s4@a5~~&^X|3xv/gyÓG(xoMiX$NJo&P񆮰ε5z"EջlO16>޿J ,?R~zF_]M?_q,\sz}gJ_)aI~ \vRk (# ? ~(׍bzO jlIZgV]~xKij?yXɢD zs]8JxKUbe^\+IUPljh(fZ8 t9qn.)*_?qc{_5LJdC<%L0m;@p'/q98z)uR;NjkU~ \.lxQ~E~EWޟ4Q]jxRI[$r*r'5GGі̫+) A pni(_uFRbߢo9*+KRѵ-_IԴ;#Ԭ.]j\623qYM&i֩4 5M>X(b> IwcxKE^&?l_u HuXRқW~(K[ URJQoE$^IK+Oi=_%οێ?0_ ?:Ϯ|G~_B ( ((((8PRS'Wš8PRS'WšyA",YU?>(+9Ɵ*P{ ?<]=e?5)O붗]iΝ&CkYZA)nL'^?.ׁS>:*u)Y8IppQjQdM4w=\1wq,FIJ2RN2ijng: F9%Ruw'=rK̥}Elf4̿|GgZ?_`o_^x30+} ߳M"Heq}c. _TivY[iMYDY}VV'݆"c4A ErWbq-% kn.-JUKxKb":ׄz 볳kNCEWQE|X~fmj.-.`g iwJֺEyxwOGR %GEe:УW^%V":iV:p칧9(ȫViԭVJBu*N[B"9?(6-Y2L_">_~~0X_ ºlS$M IOn5wm6Pr\(yn7$'V'NJќ<EOb-uGeEWvr47$xkT_O_Ǟ-Z +[[zi}_{uk*w]MQ(eE2Nū45{ II8)FI+4iL"O٧ #xyxSEf|kCguyy.ƺZ%W~<]i><' ̾)w^:M喩yI_?3mkVլiO|<|;ڴg|_."n󎍣FEv-u_hVń 62s>l֭lDc8l&':te*{3_|gCῃmG~=]%{@s__>9(}cO$gt*bsȪ{s8vP(L?-~? =j:G>;ŧY~-ҵsm osugiq<⮗c{;ZgMx?P>^-ɣZn3>|Tmeh=v߇u{K+-c_<7tj xFd7|EJ>#Ҽ7x⇍u5=$Y|S]kEf\Wz{)|?}~"UΕAxRYֵ%GX7u\xℾ& V-soj:w\v?!1us>#=b>6N.u)(ӋZ*jYU0RXL:t]F3noJuj+5Nq{U ^ moE~!L4kBm_tie[hf<>/Ǒv[^JT:R[]8(/iBQn26z ٦_iE٧ѭ{4¿ S-G۹"̹4{V̹h4S!ycЮOǾ Ŀx׋WR  ~О6ukZZjVn4E[)R ?')ρ㼾iu߅~>kf>$|94?ٲon"9$mvz͗5 ߍ9|#fYMZWSI{Y{jIo*e&yR#a[*Z()(8I{HO8'4ک?GOڽ (}+Bӣc<{;Ty~S}ߙiOo}/zuOeX ydcӎkP߽' su [ݾ/̩b4=0?ryw9|Q@$sr׌̸<x\6@NOZpK[Ky~{[y7oN~!]U1$(S?^ZrI'ԓ%č$Y< )?zX? o|+=O7uo)m'--ƉǮlϤ[Y_j%F xL4J8O'a&l?t~6J}7ǟωm>"E>E_ m-/Y6uqxJo.9M(Y*eY//7¯ j6ƽi)ڍ#Nc i~މ-JCfKEg}M>=~<co<[[&_׵CW5 _W/u][Uu=OQPu 乽yn.o.eIgGWy+-\Epż^WTZh^XL-(R̩ƬQUHGPጢРctݽ~ztWTIViM?rX;A~¾k>(Gi "h0xď7ë[g~"YƏ _X׮a3ew_>|V1O_ Wmr =+ eM}Z'ֱ j쥖Y^jNƿ Yo  /kl_}ʚh̋/ueJO/K3^ g_ip[0҄u9GKI}Zբ)ekJ8 LkPp3>JҎ4ս*Z3>o~ c4|{'ះ-<7}(--ޥ]mI5=w[gּA\wkzxsw+^u$c4Yp_Rt@=˭B =R&Q5_jURuNuj֩:jԓUNrr)sJM&mS)408aN+Ucb-4 k^[&Ҿ~ 4-Zj5{ő5cOCoe }Wv˴ ?ֿ)d9~:mL=\)FyGՄZy}I{45.y+ aqOEU!Z-Tҳk]Vm8YVUA9 {l# b^?)fg+WV vˍiվmo2XtJZJSյCZkBw%A'jgWb??e<[]c%o|B4;=gI+ x2O~-b3EHP%ֵ1\HDHJ4n|-V񏉾-j;–Rxo:|YT禙7٧SSͱb-P%Kδ%$vE7x] )]JszoM+]OA`g#?p7k8zo=$0S8(E>T+gkB]+Q3D ص־ ><_hu M[GusKӵ2J\ڭcpR{KH$6=+4?iO:w~ 3K= [-kI3sy$v7~͛XYK$6o<%Ok4hx hmeݞ٤[y G"23J^.XTQMTS6Qx.t'NQnK.hM/wߕ)+ٯ;5Z}oYhZj02k+ x5$iMjzTM6N>nJ.4Ok?;tZ~Wm|Qy۩ (('.f2HOv?|_{xGZҢo"͹{jZLLH5``1XY$R6h{~~mlӂ<.*dPݦqnݝC\O>'/<Mp zwmf7u$2FOGE=s * ApAAҿ ]RRn,uKk;'.-CeDua_C_}L'B~"vl8}%'nOF%F;=%%N"w:ϯKM잚;}RtɭUݞh (B>T+2~!2oX>G|eºΝzBk=OLe nBb"|i;iCCqr ޯȥBN2e'EfviOTϺM4iMjzѦa__'G7BtW WOq/8C*_5\.(=qoOg_4߃R|:n8|4>?(肊((((OCKaO_ kOCKaO_ kxGJO 9qfT0(`ۯ7CS )׏f__nRk縻I^%qAr_HOj(鐢((C~W_#)b<&<*(y1_?j(ЯG |5#~?|L__uqh+u>?~,o_$6qS-զ ~'1?((U&эU}\1)?BG5u|> (xkLUOTV?GIAET,u j?Y5.!kڏM_x?ro4?(?l2&MQ_G_,.?Cp_z_W2!,䠗?sD4QE+(?uAcW5+[>!_.o?R`cXOSӥo A#E_W?4}ծ;TG.r^|B- \ szsN帱4+ pW9?kԇ5 Lʥ׻iږ_&+EntL;~WZa8`mP G6#^*!9J+z@>ȷOZ_lTPhHּU#nqG'¹&waxG >> Gѥφ'pʇ`hhpӚx{/rNN:%M'X|ZOeK8F3_)B~j?h~,)ISNӢYѼ?Cgx_A{iVm=X-EhҧCJ 4JqJ"SB)h[#RYʭYέIu*JSrܥ&mŠ+ +Ri j",VfkKFҴ q_^%q-$95S/˩,]]r#խ' rNӣJM9_\TɲxG ^2b *\ьiQiBTI:WU?i|_xCĞ9Nc hwuĊ{(@Aa_8ӄ\9FSrҌR[IugJJ1rQS$oKV|9}O' 6o>~2@N K3 4>|Bh_L#?Ec YoI//S}9i_Mu <5mq*-O>)B-KYy?I9ibMR)ZqzRc%F:xҖ:PPG]SdN2V)ԌV_fTѣJɣץ1M.w%FF P}z~ni IbW ; +>94wJ{_w_|0lմ3Dm|WKi­-ޑtgSN_\e?^m=gkhxs"ռ?z kK$xQ|)? oς~#SC5گ>js[t캍_sgp<*?^+ YeJ_MWz>4UmR"gVsQ9^ͲF6UJzޔ6thIIjo'Ĺ|2xOS/ _2a#DƝEl][б&[)5K~Bc=~'|,m_ğxk񮅧x iſ- qevv7Qwg<1E*.;|G|[^ݼiV>yX˨Y@f ꚇ6/ke ER?2]*Xn%,)N{J)WNOaZ>zQ8s9sX ,-Yƞ&HT*ЏG)SkG'=?׏_bx!=q_/*{/:ߋXG|TgH̸?gJpNG| 5ؓ+&߳|!mrF~7 q;A(q/ WKrYF2Ӕv~:c8m{N)UɳrpI 4ޟ NP?,5˻p$$k9P$^Z/|3#]^|FRAv'ă=ߗ6b4c?O p>2eڻZ{wn{j2&E𮙪~&h*j# !c3o8?'6JYxɇ퍝F*᭯1v߀"'a)V_)/Kܢ?&Wx_ ig'T[~%nO4_ 5x-ܦ%*4.?ۯ ~zNsF^hw$fP@x⏉^;8˽'L}xk:^?ಿ oOJT>Fÿٟs٪x?KVX|;E|EXC-=x_|U/zNj|ccPM BU5oTQ5]FIno/o.%yiݘ_5a3o1|hK/|=U_*y|ʤ&Z 7ӄ!V-PTeR'p*~SUbt٥s𑼔*_|ҕ6EQ7?|Q/:]cP|K:kԗ7rKs{{w4#1nEbx71? >g>6񞹧xk~뺽vznX+quws*E"g{EfZ:&EtmWĞ%&^auZ]EcFcך^ 2]\K0?D EV>4-t6?xoXu_]FfmuK9nWbF˸uHm& qR 74NZ4gKK3V븲b2@;'9S 2_{%| :빇"PG}k~z}8RuۿVw轪=9?Og(=}*(4xw>\Avbdb] f27.JHO ~%iqK%mn=i#mћ:-<v"]4OΟᯌ}$.;x"EW84trXA${?xYq2S< T'>Z*Y(e% ~_l u,i zԡjM## 2A ?_UG/MwxRhŵH$|6H7'cH{̷"?J |h6o@Mv !еAci-ųH$D%os*ɲ8RwT1ZK5bΓm.qVrM}gX;lSntd涰ofF-mg^෍~x¾0ahzr#Zj8Tncr^OW($I_RN(V8ԥR*P( nI'JrR.%ftkUW#f.|մ[k\8uM8 imQ$4*ҥ^֧ .Yө(IofӳI&H!RtNREz54~O mmbO|3QUgcZ>>ib->zTus]F0O?waN54ޓl͎Zܨళҿ( 䒟?E7~H+(~2rKI[=Ef*< CI_^|y&oê < .fUEmѦHQF0ӴG%ŌC WaT -PT`}e);rvWܤnB|;6:wOFK&/ yaVo+_ WO/x;<-\Rt_/Ė=ӷx5=&+x?,`GE~ø9y҇ժwRT&]DRg/kJ󷤜 (?ػ_iGx'RÎihǩv4ͻҞXa@~O|N홸/ûk{5/Jۓ& *X\2|P3~N-M"l*a*h@xy.!Л H2)#G"+ee`UA~INGUPVP}b3\Nt\nH,aeT?e)nRWg{ugsE~؟.T~#MrѣN[M1Rj;6}qUժS)E;5ti;6kQ]F?_~ I_qoOg_~m/gp#/!Q_}QEQEQEQEWi(~)Z+M~Ww ]?|E]4YG ZT$Ei4k3QCan{ym%BDGgYFeZ'G/8ڰNJMNP(Ǚ-N I3ß+Vgxeq__nRk&?>I3߁?J?'K_~^ uGGi:ߎo/x_ZX-jZt@ֵ=6_YLR.uT %9vq نYRZx%N1XZ!*B2rqʝއnYk̲eLf_*xLnR0%PZYFhǙ+& +t((+x}?P?!~7 j{[t=+_˦Ol<;h*cnF"hHx/=pse*X:xeM֗0uUjR^v~aJZ:jXU XiZ/jWkhG&?>I3??I2χR|Lrß+Vgxeq_ǧg¿q??I2χR|L澽bS-km>!\w~2A|I.sᨵHt9nOem:-oTH[ B~3C%N<iGөTc|n>wKVj%A^{7MasF+VRWuԥU:n^C( ?N (?^>o^%Ifv~f,g,$ܜ?I2χR|L濦8_ٙދ}`W!qAo__o򸢿S,y'nh&?>I3xsy p4?;-_=?Nȅ<5k*ꭍegX¶VVp)fX-mbH-RV(D٘195j)-WmEr1X+QRPWֿ-dU77 9q4~dydY%啋8,I'_xsw<\n'E`/Ƅ>{z-rr^5%,%|5_êչy=*77.Y_)Lі|<“g74Êe?~?W78/+H5Qguz}q)Lі|<“g754 yy|0so 5}e4/_ KU/"\iqGdq8,YcS ,irRx7>v˒Ni^2,XZo V% Ws*RN(S*w{Q_?W_c[|U|6$k\jƭWLfww?,I,#kj~,I.GE}qFs.M*i֣7'Ԍ\iS:j瓛vwFs 29:5!RtQT Eٶ8+#o; z~ɳ_ş hq>5|;'~/|`̐ͮt"I''7CIuwM ^n|M5͟3dWƺ=ȌYM?_|pQq-9帎T^\.)J񏷙7%w,3i}X7kֽ!J+/~#J< ,~1xXG ?l-㕂D>??M^I+;<!_0Wm"XxvZ`3<}]yyCAYUY_zX_ z}kKJ"h(S_?c"ڽoWWkQx$ƻmG灗N&|9Zya]'Y#~M[oBӤ~6H:O¿ ˸^[[Qo^4k[Q_qG\AĴamM'W2h8*4&FM&}GNK87 cĨڔУr'Ru娓h(ЯO-o5]Kla'OPƿo!wcűi uzeGRH$v%r~#پcjPk w['~#i0ФPyѵ :͓8Bb} S_ګ$2&;8iS-bѪ4|hy9^-c\[~Lf"uNiV֫ۯ DҼ3hl`4?Z~i˲OҴHl4t0D;cFxZ(mmmݶޭmY+$Z$KdQE(+b~k+7i-+4ZDXu9H`t=mw^$of7:!d͟g_F ~0ӤMS.L-rD5+4%?p~.pYcuR\jTdV%&xA,,I{x 'qqW{*r&G+]# 'x&o6~'_:σF7c^OQY!x&(M^Oqywv#eX#o᷎>RωZD>xZwt72[%si1MĦR.m/Ybvh?~||g|,EGr F )V V]M8GsjՌ)7ZW%*乭L5s ]'IFl8/^ӍfڿڼC^ X5YxڳCּ) MOÚDLKi>CG@F\=zrZIѭJjӧV*BK$Fu!V:N#Rg JOZkɅVN~5YҼ;M5]-4E4y. SV/淲ӴXkh#iHјfQmI6z$նIn[vMշIn5]~%5xWԵkz֩s-j^5O WxZ xwM5[nct#K{BXඵI]?/h?^Ck:O>8"<1/ZGQpK+4v~am\Zi.muj׶z}_m!6ujŤ~&~^"Lz_c[G'Y,|O-=jIbҼ?5\[_`Tr+A[NJ5*-a%UqΝ%9=,O->jXJr_Z- wגw4쮥Q6oCO ~H~zVYGXRqxz3=y,Y;GL[ BuHQ_9wa[2jPݪTi`r:[2%< F{ά\jΤ칤IF*0b(+Ȼ#u+ ?DTI4^~UeA(Q}|{"쟴@;Qo^Rи0c]h_3 CQ5ir5TQaQEtQ@Oᆛw?Z1O|X[SMio ԋceWR $oh?U.k[o|{|ffFᧁm5+002hJ[]cw|ֶ0Iu{r\{;hKqu0˷5i%4 k &U|[E %xoK;ȉP\;G`3e.WidNSz*^S.7[xrz&f;}UBx/Ί(=_<7uOhVsI+$w]E.C0KYcr$@|j{A|z«^U62ӡ>Q>MMkkMK<=TFOK$^%칹Ì˰5Q+F=ڋjKJIkk=O#U5mJ4GF-ujW:}\Z] /̑YYx>MX]u&rֳ]A$֒IYmE'*_0x[O ~RJےkm pAqi,^Bz]pN^Q[]|nEaZH59~ q~Q_׿L29:w~!Z!<-xr/*?L |G񴩞V= #;\}z rK_O^yaoJ$ $2I=:g-MJǞ%ռEgint FTnQp:Ik?|1<3A'UW[?5dNHƙm4 V"]/Qe)Jk3z\=^ҥQ묪MzEEEh@Cj-h3yK *ښNe/jYvug`+=08zbsgMJQ[^\^\={^{&Ydw`  Np=LTTUJ1TT\|I+Zvu1RP?i̯e(ۖ2ٹ=~_I?-<[wzy_/az~)ʞ:{ƹ,N{GYC[m&?HmO_56$ X䍕5 ee`YH AW҃==rS.!p"# J)“WFJ\}v)s[N[_[{V ZUNqܝ~h mk؎ha[{xx&eheR,N$DfI#u*J _?? ..|oO wƺ%H۶Y47ZN+q[FkŠ03-pMsԪ%jS~zJ7n(b^_ xIjW[;ZI u<} ksy\űJԓ7l@/ V}?TԬ.sem gs\$ʇȌҾogq8ᦗI><0#cԥwk}$Ӥ9q`BZ^xYF[kDW5<$_k4o># մ T׆ǫ^7ywe=->3EFǦ!}{W.dVq<0[S/5Vw+?(kO&”#>rţxnȟDT{<gm4r'0=D#=SMSRTTr|Ta*#&~V/o^;?go KK),}v7us+4/Mct./Vzu}womQ'}+̯k 7U’^n4[sÕ&]U(JmsO޼Wc_<~Sx/pG^W^KogiPQ4՗L@r n6[PtN(1rSm$=s<)ەIy[Š(, ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( we[8 Y)I/߄<}7G_u9b? p`tO8 {=?ߓL#Жr-&3ėNuׁ8;Y?O<O^ _:<g5X|7\a>iWeK[X\o&I_tn*+*G/'Oa?jÝ]^G=Zq8$/#-co5;{H}_HCN*?o;29־5z LPQ- >Ĭ b,Uq ^OeZ2rmg?oa  ><;~m E,̱K}>0; ORo^hڏ~>'%햭a/D A%I=/KJ%ֵ]*[7m)?o?`j j( s./>+.d4SXҮ5u[gMi5}7R| ox$pd#UpY/eԥ:iuPa{:k:qzjPujV/G&O^G&2n5T`ZZe HK|$ҵ2ڷ~qi Y4i-DMW>DŽ|9p5gNO]c~ h|T~1~1<{m|?Mi߃<7h"/FriU qpj:ڭ$ԓ_q~e9))F-Y6NubR*҅ Oqy>˝T{%#҄Jj[8'񯭿bc~0|<6/a?s&׈'NM}o5v=꺉[S'~?Q CED~)z_Rݞ%im6+FYyojq/ti}[Kԟ+~_YE':|?|-Vۏxźц(/|UOxw8RfqmnfYXiֳ&e9vTf՜$e򵹱S^ּzaiI4Z1\5xc-mr1qڄdRON- 3P V㟊{o6 khf,ˡ[Ɠxz{Nk{;j_tQ_cqu&/5Z]'Jф tN#L&Q =(ӧMY.\'&97)6aEWQE/GooзaWwHmS^4Ks=:ି]6WMak9P&ԣϡuly!kˣͅ?S~7˖[t8+;ߴgُh/>EA0׍-u c[NЬ%#dL}C,-bcFU?ࡿOĺ%O~ZNm#\|HωlbKsᇅImQ1co;7 iףJ׼[zuͭly9l5*`_f^U~RAul,Ҧq=>0xkO|^:m-BmZ^mLO.?uG;'z.\F[:W:jTV)NTBJ҄'KMwG Ƥ!RRHpJ2JQ}i * (8[Ƃu/"/ =≴K\U,! ߌ|aokhiD7#t=2Z4jb*(TVMR!9ɨ RQMR)BU*>XE]$RmF1WrI&GwD𾁧\aiQz=i@Oxjs^%&qm|#5ٮ[xWInd$5㻟 Ez/~~!@dVvi3ʸׇ. ֍j:Wb-nSxm;Ga៌txkCtW<)/1/}ޟya,B0ķb`- \!>):8•lF& n1x4bm̨Tq^ MxE/gpќP.DڥRX)Fi OU)#/./i?Po_5o -\i &ž.,kxM]Zյ{_hշugVA~ɟ <]6G0AktoxO|ĺ<_i4]nŗOk{ ~+A0 P񯊾!ķm}x^MMf_?QuDU!,‰ J"">fx<' s,v&.?5h:X83*kj]9F7:#,%֭ሥxj2N9sj3N ]MJc: 5/g Odk:G5~Sgxg?] ]>b nuDziUK}],-_|+o|m&C&Ug=.-[wnT +Wgdžmq=73}~ot_|`/|3ÓxfU^4ɧNԯѼ'=f-SH$uH]UІGF A~'q6WRy^_ ʌ,NaM•u}MRtR|G7Z4kF2/x{%aX]UTpN:Mq\?({7RaacXiz]ivam )oieeinZG0CE**h C1O91JYsGN-w{{o9 @}7V״+DSioo[zb*(ɷP/y|Wܾ̑\_/]o>-nk<~2j.[hY%:p/8ɥu,ҹW04`n/~ x7Q43OZA|@uñear#iAz5-?jZ+wS2 ~'k* E&䅁]T[ƽ $p Ғ3tMTJ%T'>#?ƄaLx+R%.U[-V% P?4}hLF4xC|:3Ίk^\|x ]3l,>l^Wo2V Z_c^G^_hS2J[]> ᖡ31<*e+oS??QZD|f_į~>Pg?"_J<5xυD^#񝵦'џ[+CLK[+ s"oi7VjZxOF% hU/IUaq%eY R54U3|!K#:Sc'N))MUcQI5嵣(*Y~*%S3CjsS N콿n{4ǧj<9~~g"Mc]ƶsX"Mj/,YmWNjy"7|{%b :d|LM֥LUgӮq̖\?袊ఖy j-&j7,}pݎe8bʤz¼>_M Eb-.~|{g(sm 9;xVy I–^\ֵ;6 Ox$[a=^߃4 'ž? 0i5hZ.m?I{];MO K;h`~XQnQ^ngfġ,[.Z4O ˆэ<664)Sقp9te7z4U}WZRO(ࢊ((((((((((((((((((((((((((((((((((((((((((((((((((((~)#!| Q|G<ڸ~i^$tu_1ŗĹ;95{='ƗzMurjQG/  ;?K x~*|/NٚnuxOxA>;_^!!𾿧 G.n#-%wygf~-.Oo? >%^\T[xå<r+S]=~M]'⿄4Zl4_Úĥn3IglZo=WZY\n&j\% J-l=QeWʭJPnKq|ofTA`!Iįg EZXz5RjTRr^.V՟#Iۏ L -Oma$ .K,uP6e ߌV~uHgԭMS ݯg? I8oBOM{QH6-VHZom3FGYÿAFxkMk OӭbRV8N[۬WrsI?escu>(_u V] ֵDĺHzNLb^ѷ|[ -hC4΢N5Qi֧NMUiҌ%ZiՒoYs e|m:aNtViis*qMnI;??a/"'Eď>7|_[_ Z=<g(:&a/صsY .ek?Ydֵ> Aƺ_ۡ_ |[\*̈,< f6ZNKSu oIGU>/>U5 WT5m69/Byo-.bX7!(Neif4158Wqh΍,,2n*Sٯ eyWKGS V(Яʗ,ӿh.DUO]Οke_ ?-!Ed_o겿1ƶ[Qt|&mCK(IJH¤'Uw#Zօ)OXxZ*#pşj?MȓO㧁|EмQWZu  G 7Tc9R0jO sͥ_.xTc֕j-W湾cjf*3Vԩdߖ*pQFniҌ`oS`40Чv );sNssRV\Ӝ'dIQEya xk׼=GWS>$׈tM_B״MVK=KI4IX'GDeb+~3UL~jg׼i]:lK\+S_ lAEGڼI9?c{AB#A=A^-xOL=WUoqۙ+U\iҕJS܃὆*.iT$_+/iJOi]8FqK k++n-&EI`TIa'Y"ѕ-7[t:fYxI,ZfӼ?V kIk_S5XIӵ/Y=Tn~~W#?|u{c_ nb:_>Sڋ3VWGR4KS-(wo_.]߅>=K4'tMBHGV4_7.,AGTov1kc.S)䡍R4'*t\SnU9ATՏ"UcO a 9(RM;UKZURoI´3)A//5σ.¿3?2u^]qYYw>#sî d_83Rj剿ga)QQZ'jUٳ\: WU9qi:ps邨jiz6ZFX^jCcizfo%^ܼvvVVswuq$p3 łBY I9$=?Vja^{t?xO_/Dm> k+xfFn /~SK25R0x:Us ª~}jWg .J_ÏƬ$NXUV0m"Х W+SN?yjT)*tf_٪Ua-^{x]4sSQIW)Tbew͉Uc<<ƴ\^"L^:MF.NzT҅ +KQM5{Q^!Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@x-?>~syma-f.#ɩ[6i?F!.}[HՒ-%̧(h׭NZINj3*涕:q$J-5ёR:Е*VӌԄg BIIM4cMjS?G@KƝGǻkwK!iG–xL`\G&F^xW>$_׈atٻ)BA_xow+yg KEƿ*dZMܤQ_e^-f_N4150?F~Mz'Q*}[>39.n2J5uJ* t'J+G~_?gV/XypZ迴?Q|/_ij_ l[Q<fvoaN?`/o.q>'q" i{O*g:Z-̐ɬEy9sNi."wRP06n:#/N/snZSBQZz:v_ G^waoV.  xz /@φ4?AZm;GѴ{M;MO K+hm^5E|d֜9TSEF>ԗ8ҍMZ7QO(_GT.uʠ?zvJN͵ܷmQXQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ endstream endobj 17 0 obj <> stream xwTTϽwz0tzRWQf "*QD)  EbE Q{@QldFJ|yy=gs{ߵ.$/?./ '{#~<s P +=KE$^o{4+/ 6'%<2YSS %(by1'.gEv3;8 v[="ޑ-q~6#"JqEVaf"+If"&C]E) \3IKnnkˠ{qrR9q iLY2EE6601PuoJEzg_f : !$E}k>4$ v999&\D\?xCw$0nt!dqys8|O.2./Qn+\j? Z$J'@5RTP"@bv5Bmrq? Sb#958ğ%@TT&{܁ ,` `7*A 4.(,x !Bd)@j6dY@ hAP%B)@ʐ:Bz[(2CaPeGyP,T&j#U:jGnPOh2ZmC{#щt> ݀nC_B'Я1 xa0ɘu"L+Ư]~ M%8B Ʉ-rB %H \fb98 q$C2 bHB.y]K2Cv"G]FE#[ [bDDMxImIgUk%$OJHHt\RNIHISͥӤJO`etde2y2e.ʌS&ŕ¢lS.Q&.՛L-~CZʆˮ=#;JCh:4oZ*v6L{/",Ǒ)"wS.TUWhxIdh&hjvkjikjֺfh'i~]CgJW^[wn=^^m}>C?E  ɠ`6604BFIc&4?\ZѦ{L{M?Y՛71152eQeq{ yǒMK:4XcEnmƚob=megSm3 2E+h[MmY Nbolbd?Tw)giq C2e:;2;i:&9?w1sỴqsz qt+pwqst1ik׈7˻{gO/7ķ߯`r7an`fA'{C(!!M!C]BC ú%cDEDFFnōFG7Dϭp_oDUL~JݕW^]*uՙXXf8t\D\Sf9_?reg=c;KN g2!$a*!qotcRY ו[}\&% HBjDjk.-.OIWM_>a1i/soȂVfu >pp,{YvUۜ𜓫WV1XsZ_Cc^~ j7B7voܔib[[Rk[jk֮ھ7iUgd%;png.$^1힠K\|׹+]=uq>~hoa{kpٛ7/ruCˇÆČaߙzŽ{7?@?(x(l=368q~0lRmqb+N> stream JFIFddC C       h@dW7 +DulYQŗK[H?%sv`)=z<3Z.q sŵ!Wֳ-lSܞDz'{J1 -ýh1F>3~h{/Nsŵ!Wֳ- '(EkX<$?v>}ٱtw)'e3$)5Y1lS[ԅ_Z̶ 2T[Nz9N?"2ͧܤ^/c8*{W=|es.Hsŵ!Wֳ- AW5kOp5Ǐ?oC8ϯgoiZ].w%p<ݺLqZsŵ!Wֳ- ʚ3׬y[|XS?㓿hs}s[u5"1KzsMy_S˗soYQlrض&u(wbnm)}},Uר_zKtwfktOk9LQZbŷHsӒsg\h9Ml[R9x<'!M!Z}*ѷPt7^XO,oCwi5Jd-|&MlulǸ!u5mH-y,$xbaw>_R ʹv^[?C=7[&ɫA8 8-FIRk+{,c+*z>Xwk?cZ)O ǵQr{09t5Y3ݍ+{'H rٸd1 53]*)-8"fbđnI\XyW_VU /ޝ W%?\]q9+ ǵ|ʍv;ʛOVq8<[?ds$tH3L|Np(ŅSӕ,@\;=rͱמO83zO2ju5oaŀyD}h?'hkbI (-l_fr@=폩o)-?KDҿtky}d a EmM߽:tmRZ+l@R~=!95t'ky} ?)n^>cLjѳ7Ā6JOoοHJ|ɦLF-ÿho5GflhO0<^XMysq'-m4__ 3m25)Y11jeu@>o54dӳ2` {+ {W=Ǽ;N֛ȝ<ǢĀ_{݇_L}x'] `dQ_-zDWŭ5˻ߵ9}? dڰKbs}XH84q?<[oo#H< s;>6ǚ²k9^ 2N?u4GigH+[3pqy 4>_}혜XnFR-ɜ?3搬 7gNB4[zɥz( ۺS dŹ_[/ȋ{{;8h-**o[Fͳ;>h6s}ua95'&:ZOlSs9Huroiv|o;5Ϙ_[ߛŀ]]HgjEᖶdP?@ ^kV}0R^5,y'&l80|wӔpx[ΜV=o[{2[V;?g^\6dl[=2`Ցkҝ [  3@S[ԅ_ZͶ$eXBڗ1ƫ{]8Sm#{:4D3Az{SgK dzclǬD@nuf]Ψrض*e>g5ޮ6po~z66n硧y_C}]]H7_lE}\֎-H!sC֛>rض*eQ.gZlvjc鮇6at-]`eSuo;@ [3˳L{Hrض*e<Ǝ;ԧ5.nGb֧:̧m_\#&ta 2=/VupҺvL}p)jBf[Ld:\D{:GJ2ƻ3REs`W[oScMb@rVŽ!Wֳ-(&r_7>lf9Urcg+/9+bސY~-~<Έ]oFOoHUbeB*{v#N#V_@L}5fђs'}9+bޕO- Ʉb1{cWg۟c)̀fAI5mGܧ`hQbEQ P[Ԛ *)ti1  0&'56@A!1"P#2 MZhzC֚4=iMZhzC֚4=iMZhzC֚2a&΀'ZNh :u$@Iր'ZNh :u$@Iր'ZNh :u$@Iր'ZN hZ2ek@ց+ZV j+=P^$HRG%I/}؆Ȟ~/&C,x)#nH.)< d.Kd{LA!ȑ!qG^'(sf[Jى b1(sBN5K #uO/q-imOcH]BFư.KMR&^vB̆"Ԡ_fnst;)=JTR&O"eM14UtIkUځ9l ' 8 ǸԻiUos2>"[ y#xzS8;NōDP% kHw.= J-)ư5l3K ⧮to_aYr8> Sv3m-1ҟ? ǁo4egvD+ҟ? ÁƻD'1\%nIP`̞)@d 1$(@6Yq0a2Sn)&݊0RZ0:] ]*I?~D9vI*3i)u'˖d7㯈== m@֒lESVνCB ! Dx{YVz4;ZvALJgTs ) hN8umqaw@U]L+(a)4]˱ eMG*@dvܥ٢zɢ?]> gF8G2Ip/!v?tfqI5 +$,Kj 0Tj.E@tӾ94<꯲Δ?G˹vڎuTK_k]nD\7#,L^o~A{rV*NXf9z)sIBcVA%ՓM5&"ۜx՞U؝ ۔ͽW[v<՜J?%:L"o;aa2$CM$s!a݃YI-cF 29r]UDZ]!Wk]}wvQ b?ݞzc-z޵1(O yK%]ZmjYS۶XR>',0*ڷz+\*V˙ @(N@F-9ꐐrQ! u]w&+icdsM7K̖$nE|Rֲm"%$8 PeRn3ţc])S x8 ;(+w#II<{m5VXM!DA';"V=PR=sdǔc="^c5@a.)׏qոjfn3]#c_i}y>^O'ד}y>^O'ד}y>^O'ד=9½1L+ ½0L+ ½0L+ ½0L+ ½0L+ ½0L+ ½0L+ o4L+ ½0L)o>=! 01"AQa2@q#BPRb3C`?LWqqqqqqqqqqq2L+`X, `X, `X, bnq9ݔԮ\}^%]dWW@;t8i"Wcn]M.nIcOE5k+,V*܎7D4#^[)^dqq4k{@.mZR>X]g|s$u2LE%!uY[ژoxo $:=cA'8|Fˠ7wG#dnMel(!ܣڱӼ}V>_. ^аcQIPE_c; n໱R(e .w#`ekekGyQRধ1Lӎ+rWR'&OG mcrp CJ#F%Dt20@eȆhߢ\kX?O.уRrjEWgz% ::2xW2-)k>ә]TV0l ]iJUT:r0jd/?e"dtD#\Ñ-좍Ѩ궃lǵo-Gz(Z/wSV-c2)ܵQOuφ@$O τRNNsiBN&mh|.;tP5VKXF~"P<2=QNOgȪ:l~O\[;b`C7Vz_9'ʁpt} .e+on8y#WH8L3M1 ɍkl岜RqMi5ɵL,ſ;b`9#98.Y -uYXtZKg L v鹲*/ڢ|CPIW*cTJ|z}U%)fwU.fs7]nδ@gk**fFM^^n.Woy]RN_U֋H2>;M U.aQ}0THyIOTEݺn%òq'Ym Q j}oD6T;'$+5*I'[ˡaq_)sH~g~RY0 (U/Tq_>MoTWYjG(8i,٘6FkT|.Pt/6z)dm4j:]Ov麐Th}T{=&3"kcm}};7#>(؟:F>(Y5>8'n Ab[X;ԲZlḑo__.7[#Ӊ f_H4{*}QxZ<6!}Q;dY,Hr;t%bV%bV%bV%bV%bV%bV%bV`V%bV%bV%bVpdzm\r!ꝯ M]ꮮܠ6!1 0"@AQa2PqB$`?eYVUeYVUeYVUeYVUeYVUeYVTFWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWŽ'dcTnb#*OFZ9LԨhwd<7t*jǼQQj)&E3eRZ.{6=yv U5V:or|@[M?u FgMՔP6 oT35QH6f9AװG=CTնM&'9w*Z~aVNb;BʧiS!.uu]ENw+R꒭Iɒ5u'`ޛ! FQս>ܨ|fclsS<.]uZݢ1#[.H~PEU4˺.-W&iu FYjxcDcE죡rq/e+VGb 1=;eMnQa0,9I|d ʾ Ω2 [ʢxMw.--TY0*RNQer+uh>NQk}"HlVuy=+iwqEG W퐭ܷjPsX0')ݗ9TigZ>X\MO`vl-z.sFqkbg: p:.:(i\:jLU\Jil>4lÙsfX9MK͙+5>eLrss"M*T~xƵn!ny21 5w\ywT<{_%~ IC왕XZݱ:l'wص2#HlQ#uu"VBtu=Ea.Ū23|H@yG3 n 6Lo e=\pcN_u7o))o0 T:pÌU]bJCrg.BU7r]DQb&M_۶ʒ;`q&~W v_ "e7npvGd 5DKkvKSUf"u);CO]PTmRF۾U:251cϺ,EM|  =VyJ=œ vttqbӧ\fk?T9XW}Vst\[6W騣/haP޳7TnO@BsS1"Žnxnjl$ͽӸ ]j Fse$ɿkwPQ%. /@ZT%jSMD3ma;YA-7BrT>%Y&V[pW7K3"rl iY>AaT1mG$N}$l<]?[*6mL0o\ |iEE+a]NO VJk 2otN>12tf벊 AKmJa*M.2xB.3^{D5O eޘq1wLQ|>&G 8vx Fg{|{j7B܍s|۩-xf^l)zYAFsg " C4>qIm[nӊ形̵u> mɰAΙh=!js7{eKN{ 4ޥ vUuDD?*ݼ z ɥlm.vV45,ֱ\%8nR-eUi7 J,֏ ma+SSpJQuN2ٽֽy?O!"1AQ #02t456@BDERaq3Cb$%SrPcds?˅MYm(YGf7 vl1ٳ0f7 vl1ٳ0f7 vl1ٳ0f7 vl1ٳ0f7 vl1ٳ0f7 vl12|Í)%xC K(8ӢP1ݖR첗\we,e.)uvYK;]qݖR첗\we,e.)uvYK;]qݖR첗\we,e.)uvYK;]qݖR\wg (vYG;=qݖQ첏\wez,TʐhR3VM54g+m؝p )GrJBREԠlOLIsѮ.rb\RiHUQa){30DirFݢfdW-ŭm(()HG&vmMI7ZYJPml3:J*ӆ?T{霙,@K<0wVp{~TWVNnacEr\P* 92o]i0m?.iK-q-Ѵ;ƥJrL%thJ[Z/Kam%6k!-Qqw:e7Zq\:گCm.8Mkhc,[bc}8S}W SbL&ѩS=EN,(QB$4&ZMuk~!:l ݗA@I UJEa[`7$i,3ifuOO"WzC:DI[օkȸSZhbZs })Fg!6 m )Np]u /^%-0>2i/+OēVFhހ\w[&Iu'A6v,.& t)*R9 \Ufmk)&U#깭^ RMrx&%+E94qn-mҢ%?T{n&.*. Ѧ,ؕ+D^ͬ8g;dX JDrH.4~>c/%,&pMs+ m: in!j J6_8s5RJh="h8ânʄ+sӊ&|$y.ڬ#,L*a f*)YY{bse$#9 W4pҘQ_npMYBmo Vk(kZ鹕+iR6<3Y \J0n:iYo:mXG:ZbΕiQOӬ1u(m;PmsiWSrܳH#TNJ0Bnרai O*hq6p{h+ '%x*(z8KL~/7E8 ۆRUyd36ʱInRj!k>6EҥcS,U) ˀY3Ҍn.|ĥfXia6tp0C :c6BE( Ta7 @ztpїb0RDmCS,*O&{dcM@Dq96S!,\`SRMtQ0$sw.\8h)2ˮR1uWҘQ_nĶfm:L6SuFҖ.< Q```hb&^jsO,&0T$$a!btY,mP 66WXtRp@0)̈́aeny D/(*K:p< )&)2?2 Ri)'RHPX83. uɌVLHH^4 Mj¦3D[IIٶL)XO:xKL~/7J)LٴDii֛ZZ-^(l%G:Z-E]ETUlhOZoU6YiŌ8Ľ\'l?]",Ǿ*a+M0ѼtS``RdE6+\-/VdJGԡ`#`\~'꫓| d؜ ۃETv#/-i i.Y41xƙ EY*71ǫUO+)%N L~/7J$ia5Vl1r+"8j`]-QHPӅ.s!e(-M*@ J5uT-:j 0mIʙ;7(Ih֓ 0t5CH<G *3;J,/z}0NO$;xIQ9-ij-(#}l%ھNjKMm@}-j[½|!XBDBQwky2eN`Oeǹ~> tO6˯)TfJ֥r< Wu°b4Í((.KFYv`cU"cL~NJm!bP>ݪW1;bc9s[Q'L ˺0 @!RZVk.*8l_sO)z bX% )NpIMQKu4IA2t| YBZe -HM5i6PlptjS_8 ̿r#t}2 -.RhFg$ hA@tI7g4p!9 hozk)P(w,>S+Z˒5Q+\ ,XҶLҺ+YJ6'%M䛻#sqb'ˎ9=XVQZǼ'OӔ{E+U}l\.BF9q2ڂAԑӾezF)Fr#(L˺rͷ[|W -*ⲅٔKU*nکqU.!QehLT`omm P E1qV@ kNPhi8*1JH)-84̽ڶԝa̾/7G!2WTk\lK84F2`RZo qO8jLe\9%KJ'u EjP% XXO<yԳ ),tf!r)9ju:ضЄCyJy4mX``^3M0脺٪Uxim^ g$ ۃ@.18 I)5I°K%VD,)ҘQ_nB ӓ RgSMrJ@?bp`Pjzm|t$zsi | ҖAAvޕRRPO4(ًwˣBi KeT  @[j BQ)a7FUIQ50o&:x 2+63KJ޸qyD4ˮ=Q*Ab\&?.ZOB\ƌ?,aq`#l%m4`29ҎhlvιUg$ʲI+t)S̄{yUbvF_~ejxM_Zh0 B^) [JRIRpPe4wpə1u?_)JpS:*^q(ӄܻ&_Vuمx3[Gm<_JcG~>): [b`hRb Q*Q6R+X0֞e mFe\[`"aMsQf /Kiy6ӎLo!d_kl BGފs TlaӤfPf-RG !ZF+Y=rڗg!ON8NOJ1  ٽ 5?T{5[EfGAqohԘ`uOd&hgU`=7Ǹ\aWt"`PgX0m8}p&f8~iZӐ\˸TBwWe5p&fި!KGbl!3{Id+M=pPز })Fg ^2ֈ[SC8 uMKy!YM \)ɞ+BmBdYP?(Bc48$B7 Wd/}P~Zr ZUVVy%Y&BɓxTn0/e:.//]o՛,לvnaUi q~{z Z)} r#t}3q\lܜHjnI8RUJk * iDKr,y$9BG J5dawnl^i7UJJn>i%KYOhitJv%>MV|3z:S=L|pMVSj!(i7QLS*Pod3FH5/O͛Fp_ϛZqR  YxU CuMBNWz*Zil0Xm,kiwÍ4)"hs1ܿHL4ADb߂ SV00#NEɇaTaeA`m7!48XSggEJ.t?T{霶#]t6r[8iUn/DV2OV=&9I4aNMĪ95S4.o{@ բRJiR V @P(Zkd;^Q”e˰}2Ku-ZBZ.KY6H ocmŖP-6Y!!K*GQ:S= 0W7iX?v;`g3Gl Q~(?v;`g3Gl Q~(?v;`g3Gl,|P,0] C-J0ܔ\9vJiKW5lha7vIO 㷒vSGo%>dvSGo%>dvSGo%>dvSGo%>dvSGo%>`J|;y)vSO#r0Gn>`)eĔ $u-fVmZ:M34JVBX"7w]&% X S/.ڞT6S|+DۢkTl:X\V(]Au[tdq&BwS(OUpEl +aktPBj\L7+~Q˲jߜkOi,/4dUMܿH{}MkljljljljljljljljljljljljljljljljljljljljljljljޔV<K%ǒq\y.<K%ǒq\y.<K%ǒq\y.<K%ǒqW<K%ǒp7Q*!1AQa0q @P?!uguguguguguguguguguguguguguguguguguguguguguguc`k>QkN;gvퟹ?s~l;gvퟹ?s~l;gvퟹ?s~l;G%S};wxWxf/8o\>* 7IX߃d*fㄘN׎\F+DVb 6K\G5Bbi״,8X-ǐBbc^J>g/qh+ɻ@Dd,#~#vo@%~cs%&tmZlL _]̫o,akIM8y6L4up&/"%637(~&%M5mv+m)i+V^m.mA0gm)8sL[ZiU.ur{҅* abi9{lEq) _ wcRTzʸDLЦC\3;n)uc{Em.ubOWEXGQk"ٸJ1: _|÷:?(0ܸ.e #_[A4-sTh.bh'{݈AJm}s)Fwc,_B*sQ礦Pr Bf(PAJVdx>QV GTS'L9Նn.xt%[0g5WHZ[`+8Ղ*zXnc,ՖuqT^hYzIpyS;bZyˆ&v7]]b zS+z)ͽJG;(z=B0ִQ]y7A'jwG y:.T649g,"xx1ksq05*naY(%Y2hq  vzLl"> 0P\8Б"0(=OU;"}h\1K4!<_r+=.I3ovh@Jx?].0$͈c1rlBcvs06c<HR(Q̠udOʞJVM樲]kZ*1b ;ȸM/*al֬Yf+jE,o7ɡ9qG{=#v S@]]yIDClL`6|nrOG9ȵd# Hk:w[˥\I\*OF7–e,8izپ"Vq+LVWi\}BoYh<] V:GjX)pVj沞 o!7} T _?d6h5 ~=[y)E"(CKB:Q/,jMFdHCmdp Cc,FڞI0sPʁ~B˜8f 1<1cc^kiZ^[24S@Wrʳ@Cu-x}H |I\56A0j dM&ǬleH[*[Nvh1z*Epˎ˅T# 2v|ݷatoe6dڊ|=>El5P݇j醳YN ~ʴA/oHsǑ٫~y0jq]!]uQpjH0\ ' |;l!ѝ4)JnN{Fr ^U]Wu^Su}~ W$iWsq_6(JjE@m4kz# :x> WcM)Hhk+yY>ͼLoL)AV-+.bU &6R*F8=bC(S0T6y 邏6nFкdҥp/lS&fs|`]zKz)t}!*_2^- Xm ťBavIĈ䌭RV( IVHkk /8] sitoc.l~4 e@mb,KSK@p_- @e}**hz__h$+5qP ZWikQ#OBJ:C}'t_"l8 i*z쪵$bUN/r kTB05ᙯ9x+ڜg>ܬgPh}B"4M8_o$f@짩a u\z}"8 qwlNhM|6cm«@ U#֠u+om$1( ]5G Lv(8ͨ[Ybhxbs+Z[⸂c~'sF*.0`U`ْnoMzAgΡsJa"v? BKI0gW_/ B{s:ƞEK{g3>Aџ{2> ^HZWGO_ -%WGa<"7y+/Rfy>TnW| jvb  ` D]  .<|3DERRղm!@~0چ|v0ǜ{Je o@6rIU'I}Uh,( ~2P 9rhgF|kLa\](Ags/M;H5]@& LSMʥ:2Lg q5.yMvMҪb91A% iQG0l+xCn 90NmE$q%x@5ޱ&m忄A),,S~ZEնv_ʮHXV*ѯvke ׸f\Q" VN{EhLl6|Q5`ngo;s3%-Ta2 J+N '2KTcM5\Js̰cEaF~ LڃЇCD=v_x(l33@m!x/^i4=QiĺBYd?r`2\^As b`Uo.Xو^t@<@ c]+U2*T*u.eHZ7"zAv,\D ۪?[(gMGΑQa~ ׸?p0ǔdEE`2FZ=X%^XVL.P%Tʥ"=>QnC9`0 <.F.@VjKspii+Sыz&6i=`t| ,FYiSg4gU%dcDz}n]3N3AUIh걞Ӊs}~lnjyt Ym}WOCVif"W]+={VS`C;H(CYPbNCZ ?w,KPu3i4`F⢦ z!9Pnl28@(@m-{Ҍ/\Bp"[טx8HSSln}^֥!6,x! pr؁n9Lh 1,}CP/ kt|4 ံ"mW=KvpD&X [Z+%),L t|ѕP\_w׸ʫڼ׍X5 C鍔7T`ⰶ&՗] ~F:)d#rG 4͑B5c1PRz^%KdT"TWiZ-?OiZ-?OiZ-(o֟'ڡu{b=udzƙS) ?O^i e~G*lA)mEb^ѠYŌƣlh=CpPYXEnUh"˂|`b,W1O ?C]>V~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~g~gTwYS33333O5 ܒI$I$I$ mI$jlI"[W-mamvټԚOg[m_n3zkm/pTkm"G|[lܩW ϯB1l'!dO^He_Rm!5d݉ j;mKWemeOR `m]~mdomvѶmjs[6mYm#z/Em/mm3[7MmI{mmاm *[mml^memmڥWmٜvmmoK 5Cm-mm{m-ml ?Fvl뷶m}W_7y1Gmm~rҳ/^mN!;e,Zl<-{=&shdE+(v=er`<0֐>=uvz4{{iuV. ,$q4z&VRS\MaOF^Ր7l?Kv7j1pe'%zX+>VUƇyp~ 3VhZ{WjyVS\% (WeeBT \iBEѽz7E+L`{)a]:f1ʉޥW)FefKQO!Ntir,V*\F5yL PKj1^q! S.|oح`ztK,(ߣ}LZx!S .jIQ9aNG{p>_6 [beXfG)t]!ۡGCLjf4u t"F/v uB+1mkG&]q0Q(W":)7xd ]^ɠԽ֥\@iq?JF-I@1RqSC8cƑl)tZb@: *g~i&O^Rb賵 w޷}(&LC\M=-eo1RU+H2OPi`oZM5w &婢wEW˰KeB0f '9:*Im!T zoˤFs̨7ȣ*bX%`sK`Y+'_Wd#X(y^KY?fOkDuk e,_Ev oljUA+E>`^=>ŢTE܇Kte0D!9!.Wѳn^cD'-P 'WtDZV IJ oo ʙQ ;&>= k<.%;1/ _6nt<}wYRKwWE2K\_"R{_ۯSzF{&F2Kz<2O-C;Ra- %=(Z0_=65^Ʀ]o?^v!u()+P_X hP#zN?YAM D{kR_[5t?T|Dڗ++kےo6ˈ7b)`2֗a 8ECfЁXP(ѮOԹ~t%kuhۂtOJA[Bao겡x=,AFeBuCѯgC*)/޽tg>yUa4~cu{ʬ̘)w#$]ޏ!0:u, m{~tG&oEmfJ;V W[vżG>>aBkV2x1/Û:MwQ/mɧwb% Kp[Lɢ>.|̲.6Ď3Ie2߱f7 s)r [8|,Tրb\>%%Lܬ/A~eW.'eP϶-4 zjN_m`WJ4zLJATqmj=/"%-@o_t&O* qe[DZHN^_;̋*mG5RֱǭoxkA0eTu]XXCDA`P`lk9vB}VerFJ+UzH>Ӂe<>G^'#^cP%ɾPֹUͫiap%Ze6@ oo:_w3 VʼlWG-^)x CDQJ fxi~[fr-':]G! ]9H_ocGjFlmI߈8 )2s輳AA+Nwf(hcG`+txqöHƾth4SneP[;8H>Ӥu}R׏1ƐGɣ4 ٚ] K%]Z .4tc;S;S;S;S;S;S;ڝڝۇEVk߶K HRVVVVVVVVVVVVVVRRRR!t=eT(2'|O>'|O>'|OV.fffa*!1A0Qaq @P?ۀIYr))))))i-;KNzcJ*TRJ*TRJ*TFyxv1^0nΙ %奥\_Fy.525]eS~[`#M i#&ݓׯK| Qh[R­Pz1!a)fP!ֹ{_ >?=2t3 ^6ZD,0"PK.[|&E=hAmJ{1X9W%KH0T3 E(Pm9̱ MZ4 Y^ %-J}(#VUk0␍1mPZEn$/:랿bt1a;&QErZW.(;\NDMƄELE–"$6c aNՖ6(0 o7^=|vb%͸yAjV`ͻ=Wa4BQRֿ2֛f.Ӗӂ9l>Tl1iet?$@X&cp|0__2ib8&j8M+nV/@&^mnTxx/?,C)Jfщ^!GBa af g9:q5ہMesي -bo`Z[]9M4{SQX-SOuk_,*:͢Zh;[zu{;@Dg_&B`[_kuQ5}HYj?q6Ӧ%z>x(WiC̸: Fԍ͂Ac 40Uy;EkݿWW'B ;HR$%XT'oZ\knAE'ר=j\ZRu Fy@JItlt/zh! q5`kk3խƃf,?Vc+:yi ]R`TAV_X)Sn^E{D+W <׬ӔE ЌZ\v_F9Znw?j᧜*t`L5q%v7-}J*TRGѫ IIIIIIIIIIIIIIIIIIIIIYXnɥm?H,)we2LS)e2ҙLS)e˗.\E2L6kkg*!1AQa 0q@P?BӧN:tӧN:tӧN:I=bhGXIe>,,,,,-Isy JJ5s蜰!VBx$5#:OƝw/iu9H%KBiNd?<9I2G7ˋ 5x 艀 `rcWP.^D&@.0:d ec)] <O{0՝F!emI^ز\ d1 R'-1rdp$p2_6ĸl 9"AAXBZ8!Hh+#@m 0o%d ~G0 *꫷pc349aO,E)~J\gABE%Ynkl)ut`ʚt`NPI\66wF ۗ:+&8vZP~>4@n.HH| OH,䢾4r`dhp쪼8o[< HjhNBfYP'Pm?S:2'!Dj֕Hg)Ő F(ҪJ.`YfA:8*B밲_  !MYL1­s8np5 z2y OibX}n D<; i, ?ͬPSLH$EґR $4Ne@Ԇ,d+Ϡ`jـĺ!ُ .%t%^2eaZwip@' fNLv[SES%<x1-+ p%n=3R`q%PlHc`|' @wQ&=%6;\ R>4?89TF7񶩀4%9m>pB@s&H?$  =/Urs#$N2 ؐp &I0eE^J!'c׏Ni6* 3^߯IR !/Xi$`MO3m3.K[X4"cIwXSd ށ''xH£p(L؟Yv}w1a"rMoLx-h[*S"mXM%WX:|*8@x9EޜU*MDw*:@mF 6+oFp.JM&b y}+΢}IA.[*"Hq߳2lF K'Y.4R_Ɋ&u)A24O#f=FT`#4*T2 $Po0vm*=B-m0j0*؊~pP27 n౲JŘ!(7gR3Gu+<6i]qJ_ $Ir/ED 5߶`1An_T] |:*C,hmn9SaP*ɻÄp"37` Ho2Ih/#rbq15NL?`+yu,͚5Q SɅzKr;P|lȌ|I&YO҉8@ӵp]P)GT^ɉH pw-N "SuIӒĒ[BOHQ!fhuhIYގCh$<}4hf@XbM&c42B h =f_1|n NdQH_:n*4F!.МoV쓒$\1×o+ߎHԞ2qQPclhp@ ,N dHY#ى O6’^5vg __+b _.Iaq1ǘTEjpHX04;L9972o֟gVMG!b4!$vrP峬`вC Z 8 xp:"I9[x2(YL 5¡ U ISuXr, &.$|+ 8$Ulʡ],F` % ZGpk[Md_:*ЛDIN|dfm[Mn2x(Rex5`w/Ն),&kHiBs_̚ 7)pt w9jZ%DY>o&3a@` c T \iҮ 'M ֠1? 1HڮHK:\r8É(f!<b6S? 1!cd0KhZɩk$뀁t DeOVq ^ zf,2D+D6ʳ%.@r8 <7<9/vA 8VmC9W8pwd)zI8DucHs8YXχ6D%~hNpe՘X$%"bd!DOS07Bv6?d}O8lrJC3=?@4rB 1CPٿ"p9񐱆[pw$OU IQtɫlteRB-zh$M8lrZǝ{`~)F25 V|ḄY^,i9'[2Q`>(a6Yj"&ە0{hɍhPˆJTAgBEm&3O1E0$ʣ@hV'I'&8 #^D(?HXETC:|umC? lN,]1ϫnAI,=Ό pDk[g@ccGh0-0 @lx2IAD!m5H3*txrZ1Aׅk ZY=)}'uJlt)I!pz]a;(=❓װ]uJxe=`cwí;fT#z\e^tKCOr J۩FMBerpXw r+t$x Kc-(`[ ^\ W \JtM0;R2m), mWj2V0xG`]:%m>4Pg8"FrӉgX쟣@{@Piiiiivc,X I<=qgM!hD C4d0Y<"k),2k-I F˃!}rM^ȑe LH%HP#*9.LS {%s" jN|+a0 ]sm9琔ɤ8Wmmmsߟ,y|~mI$`=SI'K#? endstream endobj 4 0 obj << /Type /XObject /Subtype /Form /FormType 1 /Filter /FlateDecode /BBox [0.000000 0.000000 595.276000 76.535433] /Matrix [1 0 0 1 0 0] /Resources << /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] /Font << /F2 5 0 R /F1 3 0 R >> /XObject << /I0 16 0 R >> >> /Length 194 >> stream x? 1 oԥM[?xM<CtoTtQMC~!WXK84\2CFlIOط(bQ 0)|vVNjT ձx%;Uap޸cwa endstream endobj 2 0 obj << /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] /Font << /F1 3 0 R /F2 5 0 R /F3 8 0 R >> /XObject << /XT4 4 0 R /I0 16 0 R /I1 18 0 R >> >> endobj 6 0 obj <> /H /I>> endobj 7 0 obj <> /H /I>> endobj 9 0 obj <> /H /I>> endobj 10 0 obj <> /H /I>> endobj 11 0 obj <> /H /I>> endobj 19 0 obj << /Title (Heart cells respond to stiff environments) /Subject (Heart cells respond to stiff environments) /Creator (Science X Network) /Producer (TCPDF 6.2.25 \(http://www.tcpdf.org\)) /CreationDate (D:20190617014405-04'00') /ModDate (D:20190617014405-04'00') /Trapped /False >> endobj 20 0 obj << /Type /Metadata /Subtype /XML /Length 4323 >> stream application/pdf Heart cells respond to stiff environments Heart cells respond to stiff environments 2019-06-17T01:44:05-04:00 Science X Network 2019-06-17T01:44:05-04:00 2019-06-17T01:44:05-04:00 TCPDF 6.2.25 (http://www.tcpdf.org) uuid:9d6afac9-7067-50ef-b475-fd547ac35cda uuid:9d6afac9-7067-50ef-b475-fd547ac35cda http://ns.adobe.com/pdf/1.3/ pdf Adobe PDF Schema http://ns.adobe.com/xap/1.0/mm/ xmpMM XMP Media Management Schema internal UUID based identifier for specific incarnation of a document InstanceID URI http://www.aiim.org/pdfa/ns/id/ pdfaid PDF/A ID Schema internal Part of PDF/A standard part Integer internal Amendment of PDF/A standard amd Text internal Conformance level of PDF/A standard conformance Text endstream endobj 21 0 obj << /Type /Catalog /Version /1.7 /Pages 1 0 R /Names << >> /ViewerPreferences << /Direction /L2R >> /PageLayout /SinglePage /PageMode /UseNone /OpenAction [12 0 R /FitH null] /Metadata 20 0 R >> endobj xref 0 22 0000000000 65535 f 0000004510 00000 n 0000130618 00000 n 0000004577 00000 n 0000130120 00000 n 0000004683 00000 n 0000130775 00000 n 0000131009 00000 n 0000004794 00000 n 0000131256 00000 n 0000131495 00000 n 0000131764 00000 n 0000000015 00000 n 0000000497 00000 n 0000003255 00000 n 0000003733 00000 n 0000004908 00000 n 0000092920 00000 n 0000095612 00000 n 0000131982 00000 n 0000132420 00000 n 0000136826 00000 n trailer << /Size 22 /Root 21 0 R /Info 19 0 R /ID [ <9d6afac9706750efb475fd547ac35cda> <9d6afac9706750efb475fd547ac35cda> ] >> startxref 137036 %%EOF